Incidental Mutation 'R1610:Anxa2'
Institutional Source Beutler Lab
Gene Symbol Anxa2
Ensembl Gene ENSMUSG00000032231
Gene Nameannexin A2
Synonymslipocortin II, annexin II, Cal1h, 36-kDa calelectrin
MMRRC Submission 039647-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1610 (G1)
Quality Score217
Status Not validated
Chromosomal Location69453620-69491795 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TCCC to TCC at 69489754 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034756] [ENSMUST00000123470] [ENSMUST00000136282]
Predicted Effect probably null
Transcript: ENSMUST00000034756
SMART Domains Protein: ENSMUSP00000034756
Gene: ENSMUSG00000032231

ANX 50 102 5.79e-20 SMART
ANX 122 174 1.5e-27 SMART
ANX 207 259 8.2e-11 SMART
ANX 282 334 1.6e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123470
SMART Domains Protein: ENSMUSP00000122175
Gene: ENSMUSG00000032231

ANX 50 102 5.79e-20 SMART
ANX 122 174 1.5e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000136282
SMART Domains Protein: ENSMUSP00000117855
Gene: ENSMUSG00000032231

low complexity region 14 30 N/A INTRINSIC
ANX 55 107 1.5e-27 SMART
ANX 140 192 8.2e-11 SMART
ANX 215 267 1.6e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154591
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the annexin family. Members of this calcium-dependent phospholipid-binding protein family play a role in the regulation of cellular growth and in signal transduction pathways. This protein functions as an autocrine factor which heightens osteoclast formation and bone resorption. This gene has three pseudogenes located on chromosomes 4, 9 and 10, respectively. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are viable and fertile but suffer from growth deficits, impaired angiogenesis, and increased susceptibility to thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik G T 6: 96,165,289 P258Q probably damaging Het
4930452B06Rik G T 14: 8,511,110 H435N probably benign Het
Acbd5 G A 2: 23,090,551 C312Y probably damaging Het
Adgrl1 T A 8: 83,932,373 M601K probably benign Het
Agbl4 G A 4: 111,657,168 E459K probably benign Het
Casz1 C T 4: 148,929,087 A36V possibly damaging Het
Chpf A G 1: 75,476,648 V327A probably damaging Het
Cldn23 A G 8: 35,825,930 Y135H probably damaging Het
Cobll1 C T 2: 65,133,642 D211N probably damaging Het
Cramp1l A G 17: 24,983,951 V368A probably benign Het
Dnah6 T C 6: 73,144,963 T1374A probably benign Het
Dpyd A G 3: 119,065,006 H623R probably benign Het
Dyrk2 T C 10: 118,859,925 N476S probably benign Het
Endog A T 2: 30,173,887 I267F probably damaging Het
Ephb6 A T 6: 41,614,373 K155* probably null Het
Far2 T C 6: 148,157,458 V214A possibly damaging Het
Fat2 A G 11: 55,278,924 V3003A probably damaging Het
Frg2f1 T A 4: 119,531,288 T5S possibly damaging Het
Gm14496 A T 2: 181,996,179 T349S probably benign Het
Golgb1 A G 16: 36,926,101 T2951A probably benign Het
Hc G T 2: 35,006,161 D1203E probably benign Het
Isg20 C A 7: 78,914,509 Q55K possibly damaging Het
Jph4 G T 14: 55,114,103 A152E probably damaging Het
Kcnq3 T C 15: 66,025,260 T264A probably damaging Het
Kcnq5 T G 1: 21,457,461 T463P probably damaging Het
Klra8 A G 6: 130,119,018 S204P probably damaging Het
Ldlrad1 A G 4: 107,214,875 D98G probably damaging Het
Lhfpl4 T C 6: 113,194,136 T30A possibly damaging Het
Lig1 T A 7: 13,285,340 L80Q probably damaging Het
Lmbrd2 A G 15: 9,186,612 Y558C probably benign Het
Lrrn3 G T 12: 41,452,993 L442I possibly damaging Het
Mc2r A G 18: 68,407,448 F258S probably damaging Het
Mmp16 A G 4: 18,011,582 T137A probably benign Het
Nfatc2ip A T 7: 126,387,407 S359T probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1193 A T 2: 88,678,574 K233* probably null Het
Olfr1229 T C 2: 89,282,821 H104R probably damaging Het
Olfr514 T A 7: 108,825,924 H25L probably benign Het
Olfr904 C T 9: 38,464,631 L197F probably damaging Het
Plagl1 C T 10: 13,128,962 probably benign Het
Plxnb2 A T 15: 89,158,493 S1531T probably damaging Het
Ptpn22 G A 3: 103,902,196 probably null Het
Rtn1 T A 12: 72,219,279 Q174L possibly damaging Het
Selenoo A G 15: 89,099,916 E645G probably benign Het
Serpina1a A C 12: 103,853,837 D383E possibly damaging Het
Slc6a18 T A 13: 73,668,225 Y345F probably benign Het
Smbd1 A G 16: 32,806,765 V51A possibly damaging Het
Tchh C T 3: 93,444,839 R529W unknown Het
Tmem206 A G 1: 191,345,065 D195G probably benign Het
Tonsl A T 15: 76,638,557 Y165N probably damaging Het
Trdmt1 G A 2: 13,516,059 T344I probably damaging Het
Ubash3b C A 9: 41,043,500 R116L probably damaging Het
Vmn2r94 A G 17: 18,243,733 V765A probably damaging Het
Zfp474 C T 18: 52,638,365 T30I probably benign Het
Other mutations in Anxa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Anxa2 APN 9 69483019 nonsense probably null
IGL02550:Anxa2 APN 9 69467306 missense probably benign 0.00
FR4342:Anxa2 UTSW 9 69480205 small insertion probably benign
FR4342:Anxa2 UTSW 9 69480210 small insertion probably benign
FR4548:Anxa2 UTSW 9 69480203 small insertion probably benign
FR4589:Anxa2 UTSW 9 69480210 small insertion probably benign
R1480:Anxa2 UTSW 9 69489754 frame shift probably null
R1482:Anxa2 UTSW 9 69489754 frame shift probably null
R1519:Anxa2 UTSW 9 69485241 missense probably damaging 1.00
R1609:Anxa2 UTSW 9 69489754 frame shift probably null
R1624:Anxa2 UTSW 9 69479708 missense probably benign 0.10
R1672:Anxa2 UTSW 9 69489754 frame shift probably null
R1696:Anxa2 UTSW 9 69489754 frame shift probably null
R1760:Anxa2 UTSW 9 69489767 missense probably benign 0.00
R1775:Anxa2 UTSW 9 69488081 missense possibly damaging 0.93
R1828:Anxa2 UTSW 9 69482978 missense probably damaging 1.00
R1884:Anxa2 UTSW 9 69489754 frame shift probably null
R1991:Anxa2 UTSW 9 69483816 missense probably damaging 1.00
R2020:Anxa2 UTSW 9 69483817 missense probably damaging 0.99
R2029:Anxa2 UTSW 9 69464480 missense possibly damaging 0.71
R2103:Anxa2 UTSW 9 69483816 missense probably damaging 1.00
R2129:Anxa2 UTSW 9 69476128 missense possibly damaging 0.48
R2146:Anxa2 UTSW 9 69489754 frame shift probably null
R2148:Anxa2 UTSW 9 69489754 frame shift probably null
R2149:Anxa2 UTSW 9 69489754 frame shift probably null
R2150:Anxa2 UTSW 9 69489754 frame shift probably null
R2437:Anxa2 UTSW 9 69489764 missense probably damaging 1.00
R3848:Anxa2 UTSW 9 69467342 missense probably damaging 1.00
R4036:Anxa2 UTSW 9 69488070 missense probably damaging 0.99
R4565:Anxa2 UTSW 9 69489737 missense probably damaging 1.00
R4731:Anxa2 UTSW 9 69486530 missense probably benign 0.41
R5172:Anxa2 UTSW 9 69485251 missense probably damaging 0.99
R5181:Anxa2 UTSW 9 69476065 missense probably benign 0.00
R6427:Anxa2 UTSW 9 69476149 critical splice donor site probably null
R6759:Anxa2 UTSW 9 69483821 missense probably damaging 1.00
R7725:Anxa2 UTSW 9 69480128 missense unknown
R7734:Anxa2 UTSW 9 69491482 missense probably benign 0.41
R8532:Anxa2 UTSW 9 69467312 missense probably benign 0.02
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gctgctgttgtcgaaatcc -3'
(R):5'- cacatacacatatacacacccac -3'
Posted On2014-04-24