Incidental Mutation 'R1610:Lrrn3'
ID176748
Institutional Source Beutler Lab
Gene Symbol Lrrn3
Ensembl Gene ENSMUSG00000036295
Gene Nameleucine rich repeat protein 3, neuronal
SynonymsNLRR-3
MMRRC Submission 039647-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R1610 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location41451668-41486431 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 41452993 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 442 (L442I)
Ref Sequence ENSEMBL: ENSMUSP00000043818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043884] [ENSMUST00000132121] [ENSMUST00000134965]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043884
AA Change: L442I

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043818
Gene: ENSMUSG00000036295
AA Change: L442I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LRRNT 28 73 9.17e-4 SMART
LRR 115 138 2.63e0 SMART
LRR_TYP 139 162 1.5e-4 SMART
LRR 163 186 7.55e-1 SMART
LRR 187 210 1.76e1 SMART
LRR 211 234 1.62e1 SMART
LRR 235 258 5.11e0 SMART
LRR 260 282 3.18e1 SMART
LRR 333 356 4.44e0 SMART
LRRCT 368 420 3.7e-5 SMART
IGc2 435 503 5.04e-9 SMART
FN3 521 602 3.49e0 SMART
transmembrane domain 626 648 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132121
SMART Domains Protein: ENSMUSP00000118779
Gene: ENSMUSG00000056899

DomainStartEndE-ValueType
Pfam:Peptidase_S24 38 115 7.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134965
SMART Domains Protein: ENSMUSP00000116441
Gene: ENSMUSG00000056899

DomainStartEndE-ValueType
Pfam:Peptidase_S24 38 114 6.4e-11 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutant mice exhibited increased mean percent body fat and male homozygous mutant mice exhibited enhanced glucose tolerance when compared with controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik G T 6: 96,165,289 P258Q probably damaging Het
4930452B06Rik G T 14: 8,511,110 H435N probably benign Het
Acbd5 G A 2: 23,090,551 C312Y probably damaging Het
Adgrl1 T A 8: 83,932,373 M601K probably benign Het
Agbl4 G A 4: 111,657,168 E459K probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Casz1 C T 4: 148,929,087 A36V possibly damaging Het
Chpf A G 1: 75,476,648 V327A probably damaging Het
Cldn23 A G 8: 35,825,930 Y135H probably damaging Het
Cobll1 C T 2: 65,133,642 D211N probably damaging Het
Cramp1l A G 17: 24,983,951 V368A probably benign Het
Dnah6 T C 6: 73,144,963 T1374A probably benign Het
Dpyd A G 3: 119,065,006 H623R probably benign Het
Dyrk2 T C 10: 118,859,925 N476S probably benign Het
Endog A T 2: 30,173,887 I267F probably damaging Het
Ephb6 A T 6: 41,614,373 K155* probably null Het
Far2 T C 6: 148,157,458 V214A possibly damaging Het
Fat2 A G 11: 55,278,924 V3003A probably damaging Het
Frg2f1 T A 4: 119,531,288 T5S possibly damaging Het
Gm14496 A T 2: 181,996,179 T349S probably benign Het
Golgb1 A G 16: 36,926,101 T2951A probably benign Het
Hc G T 2: 35,006,161 D1203E probably benign Het
Isg20 C A 7: 78,914,509 Q55K possibly damaging Het
Jph4 G T 14: 55,114,103 A152E probably damaging Het
Kcnq3 T C 15: 66,025,260 T264A probably damaging Het
Kcnq5 T G 1: 21,457,461 T463P probably damaging Het
Klra8 A G 6: 130,119,018 S204P probably damaging Het
Ldlrad1 A G 4: 107,214,875 D98G probably damaging Het
Lhfpl4 T C 6: 113,194,136 T30A possibly damaging Het
Lig1 T A 7: 13,285,340 L80Q probably damaging Het
Lmbrd2 A G 15: 9,186,612 Y558C probably benign Het
Mc2r A G 18: 68,407,448 F258S probably damaging Het
Mmp16 A G 4: 18,011,582 T137A probably benign Het
Nfatc2ip A T 7: 126,387,407 S359T probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1193 A T 2: 88,678,574 K233* probably null Het
Olfr1229 T C 2: 89,282,821 H104R probably damaging Het
Olfr514 T A 7: 108,825,924 H25L probably benign Het
Olfr904 C T 9: 38,464,631 L197F probably damaging Het
Plagl1 C T 10: 13,128,962 probably benign Het
Plxnb2 A T 15: 89,158,493 S1531T probably damaging Het
Ptpn22 G A 3: 103,902,196 probably null Het
Rtn1 T A 12: 72,219,279 Q174L possibly damaging Het
Selenoo A G 15: 89,099,916 E645G probably benign Het
Serpina1a A C 12: 103,853,837 D383E possibly damaging Het
Slc6a18 T A 13: 73,668,225 Y345F probably benign Het
Smbd1 A G 16: 32,806,765 V51A possibly damaging Het
Tchh C T 3: 93,444,839 R529W unknown Het
Tmem206 A G 1: 191,345,065 D195G probably benign Het
Tonsl A T 15: 76,638,557 Y165N probably damaging Het
Trdmt1 G A 2: 13,516,059 T344I probably damaging Het
Ubash3b C A 9: 41,043,500 R116L probably damaging Het
Vmn2r94 A G 17: 18,243,733 V765A probably damaging Het
Zfp474 C T 18: 52,638,365 T30I probably benign Het
Other mutations in Lrrn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Lrrn3 APN 12 41452192 intron probably benign
IGL02825:Lrrn3 APN 12 41452593 missense probably damaging 1.00
IGL02927:Lrrn3 APN 12 41453344 missense probably damaging 1.00
IGL02970:Lrrn3 APN 12 41452360 missense probably benign
IGL02995:Lrrn3 APN 12 41452217 missense probably damaging 1.00
IGL02999:Lrrn3 APN 12 41452751 missense probably benign 0.01
IGL03182:Lrrn3 APN 12 41454021 missense probably damaging 1.00
IGL03280:Lrrn3 APN 12 41454147 missense probably damaging 0.97
PIT4469001:Lrrn3 UTSW 12 41453018 missense probably benign 0.03
R0167:Lrrn3 UTSW 12 41454015 missense probably damaging 1.00
R0414:Lrrn3 UTSW 12 41453940 missense probably damaging 1.00
R0787:Lrrn3 UTSW 12 41454231 missense probably damaging 1.00
R0894:Lrrn3 UTSW 12 41454034 missense probably damaging 1.00
R1433:Lrrn3 UTSW 12 41452584 missense possibly damaging 0.74
R1834:Lrrn3 UTSW 12 41453518 missense probably damaging 1.00
R2068:Lrrn3 UTSW 12 41452996 missense probably damaging 1.00
R2871:Lrrn3 UTSW 12 41452723 missense probably benign 0.00
R2871:Lrrn3 UTSW 12 41452723 missense probably benign 0.00
R3771:Lrrn3 UTSW 12 41452870 missense probably damaging 1.00
R4408:Lrrn3 UTSW 12 41454042 missense probably benign 0.04
R4410:Lrrn3 UTSW 12 41452584 missense possibly damaging 0.74
R4684:Lrrn3 UTSW 12 41454244 missense possibly damaging 0.75
R4770:Lrrn3 UTSW 12 41452443 missense probably benign 0.08
R4927:Lrrn3 UTSW 12 41453125 missense probably damaging 1.00
R5037:Lrrn3 UTSW 12 41453595 missense probably damaging 1.00
R5482:Lrrn3 UTSW 12 41452387 missense probably benign 0.01
R5482:Lrrn3 UTSW 12 41452388 missense probably damaging 0.96
R5667:Lrrn3 UTSW 12 41452298 missense possibly damaging 0.77
R6022:Lrrn3 UTSW 12 41453430 missense probably damaging 0.96
R6087:Lrrn3 UTSW 12 41453535 missense possibly damaging 0.84
R6129:Lrrn3 UTSW 12 41453788 nonsense probably null
R6309:Lrrn3 UTSW 12 41453206 missense probably damaging 1.00
R7449:Lrrn3 UTSW 12 41453488 missense probably damaging 1.00
R7555:Lrrn3 UTSW 12 41452911 missense probably benign 0.01
R7560:Lrrn3 UTSW 12 41452713 missense possibly damaging 0.93
R8059:Lrrn3 UTSW 12 41454217 missense probably benign 0.22
R8134:Lrrn3 UTSW 12 41453048 missense probably damaging 1.00
R8798:Lrrn3 UTSW 12 41453175 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CGACTTCAAATCAGCACCGACTAGG -3'
(R):5'- GCACCATAGAGTCTTTGCCGAACC -3'

Sequencing Primer
(F):5'- AGCACCGACTAGGTTAGTTGC -3'
(R):5'- TAGAGTCTTTGCCGAACCTCAAG -3'
Posted On2014-04-24