Incidental Mutation 'R1610:Lrrn3'
ID 176748
Institutional Source Beutler Lab
Gene Symbol Lrrn3
Ensembl Gene ENSMUSG00000036295
Gene Name leucine rich repeat protein 3, neuronal
Synonyms NLRR-3
MMRRC Submission 039647-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R1610 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 41501667-41536056 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 41502992 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Isoleucine at position 442 (L442I)
Ref Sequence ENSEMBL: ENSMUSP00000043818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043884] [ENSMUST00000132121] [ENSMUST00000134965]
AlphaFold Q8CBC6
Predicted Effect possibly damaging
Transcript: ENSMUST00000043884
AA Change: L442I

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043818
Gene: ENSMUSG00000036295
AA Change: L442I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LRRNT 28 73 9.17e-4 SMART
LRR 115 138 2.63e0 SMART
LRR_TYP 139 162 1.5e-4 SMART
LRR 163 186 7.55e-1 SMART
LRR 187 210 1.76e1 SMART
LRR 211 234 1.62e1 SMART
LRR 235 258 5.11e0 SMART
LRR 260 282 3.18e1 SMART
LRR 333 356 4.44e0 SMART
LRRCT 368 420 3.7e-5 SMART
IGc2 435 503 5.04e-9 SMART
FN3 521 602 3.49e0 SMART
transmembrane domain 626 648 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132121
SMART Domains Protein: ENSMUSP00000118779
Gene: ENSMUSG00000056899

DomainStartEndE-ValueType
Pfam:Peptidase_S24 38 115 7.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134965
SMART Domains Protein: ENSMUSP00000116441
Gene: ENSMUSG00000056899

DomainStartEndE-ValueType
Pfam:Peptidase_S24 38 114 6.4e-11 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutant mice exhibited increased mean percent body fat and male homozygous mutant mice exhibited enhanced glucose tolerance when compared with controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd5 G A 2: 22,980,563 (GRCm39) C312Y probably damaging Het
Adgrl1 T A 8: 84,659,002 (GRCm39) M601K probably benign Het
Agbl4 G A 4: 111,514,365 (GRCm39) E459K probably benign Het
Anxa2 TCCC TCC 9: 69,397,036 (GRCm39) probably null Het
Casz1 C T 4: 149,013,544 (GRCm39) A36V possibly damaging Het
Cfap20dc G T 14: 8,511,110 (GRCm38) H435N probably benign Het
Chpf A G 1: 75,453,292 (GRCm39) V327A probably damaging Het
Cldn23 A G 8: 36,293,084 (GRCm39) Y135H probably damaging Het
Cobll1 C T 2: 64,963,986 (GRCm39) D211N probably damaging Het
Cramp1 A G 17: 25,202,925 (GRCm39) V368A probably benign Het
Dnah6 T C 6: 73,121,946 (GRCm39) T1374A probably benign Het
Dpyd A G 3: 118,858,655 (GRCm39) H623R probably benign Het
Dyrk2 T C 10: 118,695,830 (GRCm39) N476S probably benign Het
Endog A T 2: 30,063,899 (GRCm39) I267F probably damaging Het
Ephb6 A T 6: 41,591,307 (GRCm39) K155* probably null Het
Far2 T C 6: 148,058,956 (GRCm39) V214A possibly damaging Het
Fat2 A G 11: 55,169,750 (GRCm39) V3003A probably damaging Het
Frg2f1 T A 4: 119,388,485 (GRCm39) T5S possibly damaging Het
Gm14496 A T 2: 181,637,972 (GRCm39) T349S probably benign Het
Golgb1 A G 16: 36,746,463 (GRCm39) T2951A probably benign Het
Hc G T 2: 34,896,173 (GRCm39) D1203E probably benign Het
Isg20 C A 7: 78,564,257 (GRCm39) Q55K possibly damaging Het
Jph4 G T 14: 55,351,560 (GRCm39) A152E probably damaging Het
Kcnq3 T C 15: 65,897,109 (GRCm39) T264A probably damaging Het
Kcnq5 T G 1: 21,527,685 (GRCm39) T463P probably damaging Het
Klra8 A G 6: 130,095,981 (GRCm39) S204P probably damaging Het
Ldlrad1 A G 4: 107,072,072 (GRCm39) D98G probably damaging Het
Lhfpl4 T C 6: 113,171,097 (GRCm39) T30A possibly damaging Het
Lig1 T A 7: 13,019,266 (GRCm39) L80Q probably damaging Het
Lmbrd2 A G 15: 9,186,699 (GRCm39) Y558C probably benign Het
Mc2r A G 18: 68,540,519 (GRCm39) F258S probably damaging Het
Mmp16 A G 4: 18,011,582 (GRCm39) T137A probably benign Het
Nfatc2ip A T 7: 125,986,579 (GRCm39) S359T probably damaging Het
Nup214 C T 2: 31,924,478 (GRCm39) S1669F probably damaging Het
Nup50l G T 6: 96,142,270 (GRCm39) P258Q probably damaging Het
Or10a48 T A 7: 108,425,131 (GRCm39) H25L probably benign Het
Or4c15b T C 2: 89,113,165 (GRCm39) H104R probably damaging Het
Or4s2b A T 2: 88,508,918 (GRCm39) K233* probably null Het
Or8b1b C T 9: 38,375,927 (GRCm39) L197F probably damaging Het
Pacc1 A G 1: 191,077,262 (GRCm39) D195G probably benign Het
Plagl1 C T 10: 13,004,706 (GRCm39) probably benign Het
Plxnb2 A T 15: 89,042,696 (GRCm39) S1531T probably damaging Het
Ptpn22 G A 3: 103,809,512 (GRCm39) probably null Het
Rtn1 T A 12: 72,266,053 (GRCm39) Q174L possibly damaging Het
Selenoo A G 15: 88,984,119 (GRCm39) E645G probably benign Het
Serpina1a A C 12: 103,820,096 (GRCm39) D383E possibly damaging Het
Slc6a18 T A 13: 73,816,344 (GRCm39) Y345F probably benign Het
Smbd1 A G 16: 32,627,135 (GRCm39) V51A possibly damaging Het
Tchh C T 3: 93,352,146 (GRCm39) R529W unknown Het
Tonsl A T 15: 76,522,757 (GRCm39) Y165N probably damaging Het
Trdmt1 G A 2: 13,520,870 (GRCm39) T344I probably damaging Het
Ubash3b C A 9: 40,954,796 (GRCm39) R116L probably damaging Het
Vmn2r94 A G 17: 18,463,995 (GRCm39) V765A probably damaging Het
Zfp474 C T 18: 52,771,437 (GRCm39) T30I probably benign Het
Other mutations in Lrrn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Lrrn3 APN 12 41,502,191 (GRCm39) intron probably benign
IGL02825:Lrrn3 APN 12 41,502,592 (GRCm39) missense probably damaging 1.00
IGL02927:Lrrn3 APN 12 41,503,343 (GRCm39) missense probably damaging 1.00
IGL02970:Lrrn3 APN 12 41,502,359 (GRCm39) missense probably benign
IGL02995:Lrrn3 APN 12 41,502,216 (GRCm39) missense probably damaging 1.00
IGL02999:Lrrn3 APN 12 41,502,750 (GRCm39) missense probably benign 0.01
IGL03182:Lrrn3 APN 12 41,504,020 (GRCm39) missense probably damaging 1.00
IGL03280:Lrrn3 APN 12 41,504,146 (GRCm39) missense probably damaging 0.97
PIT4469001:Lrrn3 UTSW 12 41,503,017 (GRCm39) missense probably benign 0.03
R0167:Lrrn3 UTSW 12 41,504,014 (GRCm39) missense probably damaging 1.00
R0414:Lrrn3 UTSW 12 41,503,939 (GRCm39) missense probably damaging 1.00
R0787:Lrrn3 UTSW 12 41,504,230 (GRCm39) missense probably damaging 1.00
R0894:Lrrn3 UTSW 12 41,504,033 (GRCm39) missense probably damaging 1.00
R1433:Lrrn3 UTSW 12 41,502,583 (GRCm39) missense possibly damaging 0.74
R1834:Lrrn3 UTSW 12 41,503,517 (GRCm39) missense probably damaging 1.00
R2068:Lrrn3 UTSW 12 41,502,995 (GRCm39) missense probably damaging 1.00
R2871:Lrrn3 UTSW 12 41,502,722 (GRCm39) missense probably benign 0.00
R2871:Lrrn3 UTSW 12 41,502,722 (GRCm39) missense probably benign 0.00
R3771:Lrrn3 UTSW 12 41,502,869 (GRCm39) missense probably damaging 1.00
R4408:Lrrn3 UTSW 12 41,504,041 (GRCm39) missense probably benign 0.04
R4410:Lrrn3 UTSW 12 41,502,583 (GRCm39) missense possibly damaging 0.74
R4684:Lrrn3 UTSW 12 41,504,243 (GRCm39) missense possibly damaging 0.75
R4770:Lrrn3 UTSW 12 41,502,442 (GRCm39) missense probably benign 0.08
R4927:Lrrn3 UTSW 12 41,503,124 (GRCm39) missense probably damaging 1.00
R5037:Lrrn3 UTSW 12 41,503,594 (GRCm39) missense probably damaging 1.00
R5482:Lrrn3 UTSW 12 41,502,387 (GRCm39) missense probably damaging 0.96
R5482:Lrrn3 UTSW 12 41,502,386 (GRCm39) missense probably benign 0.01
R5667:Lrrn3 UTSW 12 41,502,297 (GRCm39) missense possibly damaging 0.77
R6022:Lrrn3 UTSW 12 41,503,429 (GRCm39) missense probably damaging 0.96
R6087:Lrrn3 UTSW 12 41,503,534 (GRCm39) missense possibly damaging 0.84
R6129:Lrrn3 UTSW 12 41,503,787 (GRCm39) nonsense probably null
R6309:Lrrn3 UTSW 12 41,503,205 (GRCm39) missense probably damaging 1.00
R7449:Lrrn3 UTSW 12 41,503,487 (GRCm39) missense probably damaging 1.00
R7555:Lrrn3 UTSW 12 41,502,910 (GRCm39) missense probably benign 0.01
R7560:Lrrn3 UTSW 12 41,502,712 (GRCm39) missense possibly damaging 0.93
R8059:Lrrn3 UTSW 12 41,504,216 (GRCm39) missense probably benign 0.22
R8134:Lrrn3 UTSW 12 41,503,047 (GRCm39) missense probably damaging 1.00
R8798:Lrrn3 UTSW 12 41,503,174 (GRCm39) missense possibly damaging 0.61
R9308:Lrrn3 UTSW 12 41,503,945 (GRCm39) missense probably damaging 1.00
R9318:Lrrn3 UTSW 12 41,503,243 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGACTTCAAATCAGCACCGACTAGG -3'
(R):5'- GCACCATAGAGTCTTTGCCGAACC -3'

Sequencing Primer
(F):5'- AGCACCGACTAGGTTAGTTGC -3'
(R):5'- TAGAGTCTTTGCCGAACCTCAAG -3'
Posted On 2014-04-24