Incidental Mutation 'R1610:Rtn1'
ID176749
Institutional Source Beutler Lab
Gene Symbol Rtn1
Ensembl Gene ENSMUSG00000021087
Gene Namereticulon 1
SynonymsRtn1-c, 0710005K15Rik, Nsp, Rtn1-b, Rtn1-a, 4930441F12Rik
MMRRC Submission 039647-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1610 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location72211752-72409054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72219279 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 174 (Q174L)
Ref Sequence ENSEMBL: ENSMUSP00000120033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021497] [ENSMUST00000078505] [ENSMUST00000137990]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021497
AA Change: Q129L

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000021497
Gene: ENSMUSG00000021087
AA Change: Q129L

DomainStartEndE-ValueType
Pfam:Reticulon 21 191 1.2e-62 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000078505
AA Change: Q701L

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077594
Gene: ENSMUSG00000021087
AA Change: Q701L

DomainStartEndE-ValueType
low complexity region 135 152 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 438 448 N/A INTRINSIC
low complexity region 473 480 N/A INTRINSIC
low complexity region 574 586 N/A INTRINSIC
Pfam:Reticulon 593 757 2.2e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000137990
AA Change: Q174L

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120033
Gene: ENSMUSG00000021087
AA Change: Q174L

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
Pfam:Reticulon 66 236 2.3e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144181
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150156
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. This gene is considered to be a specific marker for neurological diseases and cancer, and is a potential molecular target for therapy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik G T 6: 96,165,289 P258Q probably damaging Het
4930452B06Rik G T 14: 8,511,110 H435N probably benign Het
Acbd5 G A 2: 23,090,551 C312Y probably damaging Het
Adgrl1 T A 8: 83,932,373 M601K probably benign Het
Agbl4 G A 4: 111,657,168 E459K probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Casz1 C T 4: 148,929,087 A36V possibly damaging Het
Chpf A G 1: 75,476,648 V327A probably damaging Het
Cldn23 A G 8: 35,825,930 Y135H probably damaging Het
Cobll1 C T 2: 65,133,642 D211N probably damaging Het
Cramp1l A G 17: 24,983,951 V368A probably benign Het
Dnah6 T C 6: 73,144,963 T1374A probably benign Het
Dpyd A G 3: 119,065,006 H623R probably benign Het
Dyrk2 T C 10: 118,859,925 N476S probably benign Het
Endog A T 2: 30,173,887 I267F probably damaging Het
Ephb6 A T 6: 41,614,373 K155* probably null Het
Far2 T C 6: 148,157,458 V214A possibly damaging Het
Fat2 A G 11: 55,278,924 V3003A probably damaging Het
Frg2f1 T A 4: 119,531,288 T5S possibly damaging Het
Gm14496 A T 2: 181,996,179 T349S probably benign Het
Golgb1 A G 16: 36,926,101 T2951A probably benign Het
Hc G T 2: 35,006,161 D1203E probably benign Het
Isg20 C A 7: 78,914,509 Q55K possibly damaging Het
Jph4 G T 14: 55,114,103 A152E probably damaging Het
Kcnq3 T C 15: 66,025,260 T264A probably damaging Het
Kcnq5 T G 1: 21,457,461 T463P probably damaging Het
Klra8 A G 6: 130,119,018 S204P probably damaging Het
Ldlrad1 A G 4: 107,214,875 D98G probably damaging Het
Lhfpl4 T C 6: 113,194,136 T30A possibly damaging Het
Lig1 T A 7: 13,285,340 L80Q probably damaging Het
Lmbrd2 A G 15: 9,186,612 Y558C probably benign Het
Lrrn3 G T 12: 41,452,993 L442I possibly damaging Het
Mc2r A G 18: 68,407,448 F258S probably damaging Het
Mmp16 A G 4: 18,011,582 T137A probably benign Het
Nfatc2ip A T 7: 126,387,407 S359T probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1193 A T 2: 88,678,574 K233* probably null Het
Olfr1229 T C 2: 89,282,821 H104R probably damaging Het
Olfr514 T A 7: 108,825,924 H25L probably benign Het
Olfr904 C T 9: 38,464,631 L197F probably damaging Het
Plagl1 C T 10: 13,128,962 probably benign Het
Plxnb2 A T 15: 89,158,493 S1531T probably damaging Het
Ptpn22 G A 3: 103,902,196 probably null Het
Selenoo A G 15: 89,099,916 E645G probably benign Het
Serpina1a A C 12: 103,853,837 D383E possibly damaging Het
Slc6a18 T A 13: 73,668,225 Y345F probably benign Het
Smbd1 A G 16: 32,806,765 V51A possibly damaging Het
Tchh C T 3: 93,444,839 R529W unknown Het
Tmem206 A G 1: 191,345,065 D195G probably benign Het
Tonsl A T 15: 76,638,557 Y165N probably damaging Het
Trdmt1 G A 2: 13,516,059 T344I probably damaging Het
Ubash3b C A 9: 41,043,500 R116L probably damaging Het
Vmn2r94 A G 17: 18,243,733 V765A probably damaging Het
Zfp474 C T 18: 52,638,365 T30I probably benign Het
Other mutations in Rtn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Rtn1 APN 12 72408511 missense probably benign 0.18
IGL01335:Rtn1 APN 12 72308350 missense probably benign
IGL01394:Rtn1 APN 12 72308416 missense probably benign 0.00
IGL01551:Rtn1 APN 12 72216935 missense possibly damaging 0.63
IGL01865:Rtn1 APN 12 72219300 missense probably damaging 1.00
IGL02585:Rtn1 APN 12 72308155 critical splice donor site probably null
PIT4802001:Rtn1 UTSW 12 72304326 missense probably benign 0.21
R0104:Rtn1 UTSW 12 72308845 missense probably damaging 0.99
R0866:Rtn1 UTSW 12 72308382 nonsense probably null
R1099:Rtn1 UTSW 12 72304467 splice site probably null
R1438:Rtn1 UTSW 12 72304413 missense probably damaging 0.98
R1694:Rtn1 UTSW 12 72223524 missense probably damaging 1.00
R1869:Rtn1 UTSW 12 72308168 missense probably damaging 1.00
R1888:Rtn1 UTSW 12 72236533 intron probably benign
R1889:Rtn1 UTSW 12 72304410 missense possibly damaging 0.87
R1892:Rtn1 UTSW 12 72212563 missense probably damaging 1.00
R2418:Rtn1 UTSW 12 72304278 missense probably benign
R2760:Rtn1 UTSW 12 72408362 missense probably benign 0.00
R2973:Rtn1 UTSW 12 72223389 missense probably damaging 1.00
R4567:Rtn1 UTSW 12 72212487 utr 3 prime probably benign
R4880:Rtn1 UTSW 12 72217458 missense possibly damaging 0.88
R4945:Rtn1 UTSW 12 72217484 missense probably damaging 1.00
R6183:Rtn1 UTSW 12 72408491 missense probably benign 0.09
R6493:Rtn1 UTSW 12 72308329 missense probably damaging 0.99
R6547:Rtn1 UTSW 12 72308761 missense possibly damaging 0.59
R6602:Rtn1 UTSW 12 72219318 missense probably damaging 0.99
R7474:Rtn1 UTSW 12 72308390 missense possibly damaging 0.87
R7615:Rtn1 UTSW 12 72304143 missense probably damaging 1.00
R7697:Rtn1 UTSW 12 72408377 missense probably benign 0.32
R7748:Rtn1 UTSW 12 72216926 missense possibly damaging 0.53
R7754:Rtn1 UTSW 12 72308429 missense probably damaging 0.96
R7834:Rtn1 UTSW 12 72304032 missense probably damaging 0.99
R7970:Rtn1 UTSW 12 72308874 missense probably benign 0.06
R8290:Rtn1 UTSW 12 72308419 missense probably benign 0.07
R8311:Rtn1 UTSW 12 72304064 missense probably damaging 1.00
R8440:Rtn1 UTSW 12 72223399 missense probably damaging 1.00
Z1177:Rtn1 UTSW 12 72308864 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGGCACAGGTCTTTCACTTAGATGC -3'
(R):5'- TTGAAGGTGACCCAGCCACAGTAG -3'

Sequencing Primer
(F):5'- cgcctcttctctgagcc -3'
(R):5'- ACAGTAGTCCCAGTGTGACG -3'
Posted On2014-04-24