Mutagenetix > Incidental Mutation

Incidental Mutation 'R1610:Plxnb2'

176758

Institutional Source

Beutler Lab

Gene Symbol

Plxnb2

Ensembl Gene

ENSMUSG00000036606

Gene Name

plexin B2

Synonyms

Debt, 1110007H23Rik

MMRRC Submission

039647-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.955) question?

Stock #

R1610 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

89155549-89180788 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 89158493 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1531 (S1531T)

Ref Sequence

ENSEMBL: ENSMUSP00000104955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]

AlphaFold

B2RXS4

Predicted Effect

probably damaging
Transcript: ENSMUST00000060808
AA Change: S1531T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: S1531T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1275	1809	1.6e-225	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000109331
AA Change: S1531T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: S1531T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1274	1809	4.4e-251	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139372

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143014

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151418

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197760

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229966

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230393

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	G	T	6: 96,165,289	P258Q	probably damaging	Het
4930452B06Rik	G	T	14: 8,511,110	H435N	probably benign	Het
Acbd5	G	A	2: 23,090,551	C312Y	probably damaging	Het
Adgrl1	T	A	8: 83,932,373	M601K	probably benign	Het
Agbl4	G	A	4: 111,657,168	E459K	probably benign	Het
Anxa2	TCCC	TCC	9: 69,489,754		probably null	Het
Casz1	C	T	4: 148,929,087	A36V	possibly damaging	Het
Chpf	A	G	1: 75,476,648	V327A	probably damaging	Het
Cldn23	A	G	8: 35,825,930	Y135H	probably damaging	Het
Cobll1	C	T	2: 65,133,642	D211N	probably damaging	Het
Cramp1l	A	G	17: 24,983,951	V368A	probably benign	Het
Dnah6	T	C	6: 73,144,963	T1374A	probably benign	Het
Dpyd	A	G	3: 119,065,006	H623R	probably benign	Het
Dyrk2	T	C	10: 118,859,925	N476S	probably benign	Het
Endog	A	T	2: 30,173,887	I267F	probably damaging	Het
Ephb6	A	T	6: 41,614,373	K155*	probably null	Het
Far2	T	C	6: 148,157,458	V214A	possibly damaging	Het
Fat2	A	G	11: 55,278,924	V3003A	probably damaging	Het
Frg2f1	T	A	4: 119,531,288	T5S	possibly damaging	Het
Gm14496	A	T	2: 181,996,179	T349S	probably benign	Het
Golgb1	A	G	16: 36,926,101	T2951A	probably benign	Het
Hc	G	T	2: 35,006,161	D1203E	probably benign	Het
Isg20	C	A	7: 78,914,509	Q55K	possibly damaging	Het
Jph4	G	T	14: 55,114,103	A152E	probably damaging	Het
Kcnq3	T	C	15: 66,025,260	T264A	probably damaging	Het
Kcnq5	T	G	1: 21,457,461	T463P	probably damaging	Het
Klra8	A	G	6: 130,119,018	S204P	probably damaging	Het
Ldlrad1	A	G	4: 107,214,875	D98G	probably damaging	Het
Lhfpl4	T	C	6: 113,194,136	T30A	possibly damaging	Het
Lig1	T	A	7: 13,285,340	L80Q	probably damaging	Het
Lmbrd2	A	G	15: 9,186,612	Y558C	probably benign	Het
Lrrn3	G	T	12: 41,452,993	L442I	possibly damaging	Het
Mc2r	A	G	18: 68,407,448	F258S	probably damaging	Het
Mmp16	A	G	4: 18,011,582	T137A	probably benign	Het
Nfatc2ip	A	T	7: 126,387,407	S359T	probably damaging	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Olfr1193	A	T	2: 88,678,574	K233*	probably null	Het
Olfr1229	T	C	2: 89,282,821	H104R	probably damaging	Het
Olfr514	T	A	7: 108,825,924	H25L	probably benign	Het
Olfr904	C	T	9: 38,464,631	L197F	probably damaging	Het
Plagl1	C	T	10: 13,128,962		probably benign	Het
Ptpn22	G	A	3: 103,902,196		probably null	Het
Rtn1	T	A	12: 72,219,279	Q174L	possibly damaging	Het
Selenoo	A	G	15: 89,099,916	E645G	probably benign	Het
Serpina1a	A	C	12: 103,853,837	D383E	possibly damaging	Het
Slc6a18	T	A	13: 73,668,225	Y345F	probably benign	Het
Smbd1	A	G	16: 32,806,765	V51A	possibly damaging	Het
Tchh	C	T	3: 93,444,839	R529W	unknown	Het
Tmem206	A	G	1: 191,345,065	D195G	probably benign	Het
Tonsl	A	T	15: 76,638,557	Y165N	probably damaging	Het
Trdmt1	G	A	2: 13,516,059	T344I	probably damaging	Het
Ubash3b	C	A	9: 41,043,500	R116L	probably damaging	Het
Vmn2r94	A	G	17: 18,243,733	V765A	probably damaging	Het
Zfp474	C	T	18: 52,638,365	T30I	probably benign	Het

Other mutations in Plxnb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00546:Plxnb2	APN	15	89162366	splice site	probably benign
IGL01574:Plxnb2	APN	15	89162683	splice site	probably null
IGL01695:Plxnb2	APN	15	89157214	missense	possibly damaging	0.96
IGL01763:Plxnb2	APN	15	89161981	splice site	probably null
IGL01921:Plxnb2	APN	15	89164271	missense	possibly damaging	0.78
IGL02129:Plxnb2	APN	15	89160410	missense	probably benign	0.04
IGL02153:Plxnb2	APN	15	89165813	nonsense	probably null
IGL02637:Plxnb2	APN	15	89164057	missense	possibly damaging	0.53
IGL02892:Plxnb2	APN	15	89161222	critical splice donor site	probably null
IGL03108:Plxnb2	APN	15	89158031	missense	probably benign	0.32
IGL03115:Plxnb2	APN	15	89162438	splice site	probably benign
P0040:Plxnb2	UTSW	15	89162935	missense	probably damaging	1.00
R0022:Plxnb2	UTSW	15	89163276	critical splice donor site	probably null
R0095:Plxnb2	UTSW	15	89165331	missense	probably benign
R0103:Plxnb2	UTSW	15	89161769	missense	possibly damaging	0.85
R0544:Plxnb2	UTSW	15	89158613	splice site	probably benign
R0671:Plxnb2	UTSW	15	89157981	missense	probably benign	0.14
R1279:Plxnb2	UTSW	15	89162321	missense	probably benign	0.02
R1530:Plxnb2	UTSW	15	89167192	missense	probably benign
R1542:Plxnb2	UTSW	15	89165921	missense	probably damaging	1.00
R1686:Plxnb2	UTSW	15	89162462	missense	probably damaging	1.00
R1702:Plxnb2	UTSW	15	89161984	critical splice donor site	probably null
R1996:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R1997:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R2031:Plxnb2	UTSW	15	89162810	nonsense	probably null
R2049:Plxnb2	UTSW	15	89159002	missense	probably damaging	1.00
R2072:Plxnb2	UTSW	15	89158451	missense	probably damaging	1.00
R2076:Plxnb2	UTSW	15	89158026	missense	probably damaging	1.00
R2140:Plxnb2	UTSW	15	89156562	missense	probably benign	0.04
R2418:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R2419:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R3752:Plxnb2	UTSW	15	89157255	splice site	probably benign
R3825:Plxnb2	UTSW	15	89166399	missense	probably benign	0.05
R4154:Plxnb2	UTSW	15	89159642	missense	probably damaging	0.98
R4197:Plxnb2	UTSW	15	89157018	missense	probably damaging	1.00
R4385:Plxnb2	UTSW	15	89160623	missense	probably damaging	0.96
R4434:Plxnb2	UTSW	15	89162803	missense	probably damaging	1.00
R4678:Plxnb2	UTSW	15	89160928	missense	probably benign	0.37
R4717:Plxnb2	UTSW	15	89157419	nonsense	probably null
R4773:Plxnb2	UTSW	15	89166947	missense	probably benign	0.06
R4905:Plxnb2	UTSW	15	89157411	missense	probably damaging	1.00
R5368:Plxnb2	UTSW	15	89159593	missense	possibly damaging	0.94
R5418:Plxnb2	UTSW	15	89166491	missense	probably benign	0.00
R5484:Plxnb2	UTSW	15	89164209	splice site	probably null
R5520:Plxnb2	UTSW	15	89167543	missense	possibly damaging	0.65
R5566:Plxnb2	UTSW	15	89164020	missense	probably benign	0.05
R5568:Plxnb2	UTSW	15	89157435	missense	probably damaging	1.00
R5619:Plxnb2	UTSW	15	89162809	missense	possibly damaging	0.92
R5685:Plxnb2	UTSW	15	89167032	missense	probably damaging	1.00
R5688:Plxnb2	UTSW	15	89158696	missense	probably damaging	1.00
R5809:Plxnb2	UTSW	15	89167571	missense	possibly damaging	0.61
R5813:Plxnb2	UTSW	15	89160759	missense	possibly damaging	0.81
R5866:Plxnb2	UTSW	15	89167572	missense	probably damaging	1.00
R6016:Plxnb2	UTSW	15	89161022	missense	possibly damaging	0.55
R6117:Plxnb2	UTSW	15	89158000	missense	probably benign	0.04
R6187:Plxnb2	UTSW	15	89167258	missense	probably damaging	1.00
R6260:Plxnb2	UTSW	15	89165291	missense	probably benign	0.22
R6263:Plxnb2	UTSW	15	89161986	missense	probably damaging	0.99
R6269:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
R6351:Plxnb2	UTSW	15	89157770	missense	possibly damaging	0.95
R6522:Plxnb2	UTSW	15	89164426	missense	probably benign	0.18
R6856:Plxnb2	UTSW	15	89164320	missense	probably benign	0.27
R6930:Plxnb2	UTSW	15	89160389	missense	probably benign
R7354:Plxnb2	UTSW	15	89165725	missense	possibly damaging	0.92
R7513:Plxnb2	UTSW	15	89158322	critical splice acceptor site	probably null
R7522:Plxnb2	UTSW	15	89161774	missense	probably benign	0.20
R7730:Plxnb2	UTSW	15	89162330	missense	probably benign
R7766:Plxnb2	UTSW	15	89161271	missense	probably benign	0.01
R7781:Plxnb2	UTSW	15	89157022	missense	possibly damaging	0.89
R8126:Plxnb2	UTSW	15	89163303	missense	probably benign
R8131:Plxnb2	UTSW	15	89158713	missense	probably damaging	1.00
R8372:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
R8736:Plxnb2	UTSW	15	89162058	missense	probably damaging	1.00
R8772:Plxnb2	UTSW	15	89162746	missense	probably damaging	1.00
R9022:Plxnb2	UTSW	15	89164268	missense	possibly damaging	0.59
R9044:Plxnb2	UTSW	15	89160363	splice site	probably benign
R9253:Plxnb2	UTSW	15	89167812	missense	probably benign
R9398:Plxnb2	UTSW	15	89160919	missense	probably benign	0.02
R9562:Plxnb2	UTSW	15	89165933	missense	probably damaging	1.00
R9568:Plxnb2	UTSW	15	89160957	nonsense	probably null
R9613:Plxnb2	UTSW	15	89164293	missense	probably benign	0.01
X0027:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
Z1177:Plxnb2	UTSW	15	89159096	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATAGACTTACGCTCCCCTGGCAAG -3'
(R):5'- AGGTCCTCAACTGTGACACCATCTC -3'

Sequencing Primer
(F):5'- TCCCACCTTAGACAGGATGAG -3'
(R):5'- ACTGTGACACCATCTCTCAGG -3'

Posted On

2014-04-24