Mutagenetix > Incidental Mutation

Incidental Mutation 'R1610:Cramp1l'

176762

Institutional Source

Beutler Lab

Gene Symbol

Cramp1l

Ensembl Gene

ENSMUSG00000038002

Gene Name

cramped chromatin regulator homolog 1

Synonyms

5830477H08Rik, Tce4

MMRRC Submission

039647-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1610 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24961228-25015230 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24983951 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 368 (V368A)

Ref Sequence

ENSEMBL: ENSMUSP00000073060 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073337]

AlphaFold

Q6PG95

Predicted Effect

probably benign
Transcript: ENSMUST00000073337
AA Change: V368A

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000073060
Gene: ENSMUSG00000038002
AA Change: V368A

Domain	Start	End	E-Value	Type
low complexity region	11	20	N/A	INTRINSIC
low complexity region	29	43	N/A	INTRINSIC
low complexity region	51	64	N/A	INTRINSIC
low complexity region	100	126	N/A	INTRINSIC
low complexity region	134	147	N/A	INTRINSIC
SANT	159	219	3.68e-3	SMART
low complexity region	479	503	N/A	INTRINSIC
low complexity region	548	562	N/A	INTRINSIC
low complexity region	792	803	N/A	INTRINSIC
low complexity region	833	845	N/A	INTRINSIC
low complexity region	889	903	N/A	INTRINSIC
low complexity region	1069	1086	N/A	INTRINSIC
low complexity region	1113	1124	N/A	INTRINSIC
low complexity region	1141	1156	N/A	INTRINSIC
low complexity region	1171	1185	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	G	T	6: 96,165,289	P258Q	probably damaging	Het
4930452B06Rik	G	T	14: 8,511,110	H435N	probably benign	Het
Acbd5	G	A	2: 23,090,551	C312Y	probably damaging	Het
Adgrl1	T	A	8: 83,932,373	M601K	probably benign	Het
Agbl4	G	A	4: 111,657,168	E459K	probably benign	Het
Anxa2	TCCC	TCC	9: 69,489,754		probably null	Het
Casz1	C	T	4: 148,929,087	A36V	possibly damaging	Het
Chpf	A	G	1: 75,476,648	V327A	probably damaging	Het
Cldn23	A	G	8: 35,825,930	Y135H	probably damaging	Het
Cobll1	C	T	2: 65,133,642	D211N	probably damaging	Het
Dnah6	T	C	6: 73,144,963	T1374A	probably benign	Het
Dpyd	A	G	3: 119,065,006	H623R	probably benign	Het
Dyrk2	T	C	10: 118,859,925	N476S	probably benign	Het
Endog	A	T	2: 30,173,887	I267F	probably damaging	Het
Ephb6	A	T	6: 41,614,373	K155*	probably null	Het
Far2	T	C	6: 148,157,458	V214A	possibly damaging	Het
Fat2	A	G	11: 55,278,924	V3003A	probably damaging	Het
Frg2f1	T	A	4: 119,531,288	T5S	possibly damaging	Het
Gm14496	A	T	2: 181,996,179	T349S	probably benign	Het
Golgb1	A	G	16: 36,926,101	T2951A	probably benign	Het
Hc	G	T	2: 35,006,161	D1203E	probably benign	Het
Isg20	C	A	7: 78,914,509	Q55K	possibly damaging	Het
Jph4	G	T	14: 55,114,103	A152E	probably damaging	Het
Kcnq3	T	C	15: 66,025,260	T264A	probably damaging	Het
Kcnq5	T	G	1: 21,457,461	T463P	probably damaging	Het
Klra8	A	G	6: 130,119,018	S204P	probably damaging	Het
Ldlrad1	A	G	4: 107,214,875	D98G	probably damaging	Het
Lhfpl4	T	C	6: 113,194,136	T30A	possibly damaging	Het
Lig1	T	A	7: 13,285,340	L80Q	probably damaging	Het
Lmbrd2	A	G	15: 9,186,612	Y558C	probably benign	Het
Lrrn3	G	T	12: 41,452,993	L442I	possibly damaging	Het
Mc2r	A	G	18: 68,407,448	F258S	probably damaging	Het
Mmp16	A	G	4: 18,011,582	T137A	probably benign	Het
Nfatc2ip	A	T	7: 126,387,407	S359T	probably damaging	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Olfr1193	A	T	2: 88,678,574	K233*	probably null	Het
Olfr1229	T	C	2: 89,282,821	H104R	probably damaging	Het
Olfr514	T	A	7: 108,825,924	H25L	probably benign	Het
Olfr904	C	T	9: 38,464,631	L197F	probably damaging	Het
Plagl1	C	T	10: 13,128,962		probably benign	Het
Plxnb2	A	T	15: 89,158,493	S1531T	probably damaging	Het
Ptpn22	G	A	3: 103,902,196		probably null	Het
Rtn1	T	A	12: 72,219,279	Q174L	possibly damaging	Het
Selenoo	A	G	15: 89,099,916	E645G	probably benign	Het
Serpina1a	A	C	12: 103,853,837	D383E	possibly damaging	Het
Slc6a18	T	A	13: 73,668,225	Y345F	probably benign	Het
Smbd1	A	G	16: 32,806,765	V51A	possibly damaging	Het
Tchh	C	T	3: 93,444,839	R529W	unknown	Het
Tmem206	A	G	1: 191,345,065	D195G	probably benign	Het
Tonsl	A	T	15: 76,638,557	Y165N	probably damaging	Het
Trdmt1	G	A	2: 13,516,059	T344I	probably damaging	Het
Ubash3b	C	A	9: 41,043,500	R116L	probably damaging	Het
Vmn2r94	A	G	17: 18,243,733	V765A	probably damaging	Het
Zfp474	C	T	18: 52,638,365	T30I	probably benign	Het

Other mutations in Cramp1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00566:Cramp1l	APN	17	24983951	missense	probably benign	0.11
IGL01360:Cramp1l	APN	17	24997573	missense	probably damaging	1.00
IGL01966:Cramp1l	APN	17	24982943	missense	probably benign	0.01
IGL02211:Cramp1l	APN	17	24977636	missense	possibly damaging	0.94
IGL02474:Cramp1l	APN	17	24985050	missense	probably damaging	0.98
IGL02798:Cramp1l	APN	17	24968920	splice site	probably benign
IGL03340:Cramp1l	APN	17	24973542	missense	probably damaging	1.00
R0106:Cramp1l	UTSW	17	24972376	missense	probably benign	0.30
R1054:Cramp1l	UTSW	17	24983177	missense	probably damaging	1.00
R1220:Cramp1l	UTSW	17	24982237	missense	probably damaging	1.00
R1341:Cramp1l	UTSW	17	24977540	missense	probably damaging	1.00
R1491:Cramp1l	UTSW	17	24972349	missense	probably benign	0.17
R1649:Cramp1l	UTSW	17	24983243	missense	probably damaging	1.00
R1795:Cramp1l	UTSW	17	24964910	missense	probably damaging	1.00
R1856:Cramp1l	UTSW	17	24968978	missense	probably damaging	1.00
R1881:Cramp1l	UTSW	17	24977682	splice site	probably benign
R1968:Cramp1l	UTSW	17	24964939	missense	probably damaging	1.00
R2047:Cramp1l	UTSW	17	25003215	nonsense	probably null
R2099:Cramp1l	UTSW	17	24973085	missense	probably benign	0.01
R2298:Cramp1l	UTSW	17	24997480	missense	probably damaging	0.96
R3752:Cramp1l	UTSW	17	24971558	missense	probably damaging	1.00
R3821:Cramp1l	UTSW	17	24974782	missense	probably damaging	1.00
R3861:Cramp1l	UTSW	17	24997614	splice site	probably benign
R4399:Cramp1l	UTSW	17	24979585	missense	probably damaging	1.00
R4847:Cramp1l	UTSW	17	24985089	missense	probably damaging	1.00
R4883:Cramp1l	UTSW	17	24982319	missense	probably benign
R5579:Cramp1l	UTSW	17	24973113	missense	possibly damaging	0.89
R5631:Cramp1l	UTSW	17	24985603	missense	possibly damaging	0.93
R5716:Cramp1l	UTSW	17	24974735	missense	probably damaging	0.99
R6589:Cramp1l	UTSW	17	24977492	splice site	probably null
R6631:Cramp1l	UTSW	17	24983957	missense	probably benign	0.40
R7307:Cramp1l	UTSW	17	24974745	missense	possibly damaging	0.94
R7323:Cramp1l	UTSW	17	24982405	missense	possibly damaging	0.90
R7672:Cramp1l	UTSW	17	24982466	missense	probably damaging	0.96
R7832:Cramp1l	UTSW	17	24983222	missense	probably damaging	0.96
R8071:Cramp1l	UTSW	17	24982700	missense	probably damaging	0.99
R8244:Cramp1l	UTSW	17	24971410	missense	probably damaging	1.00
R8430:Cramp1l	UTSW	17	24977562	missense	probably damaging	1.00
R8783:Cramp1l	UTSW	17	24974758	missense	probably damaging	0.99
R8890:Cramp1l	UTSW	17	24983140	missense	probably damaging	1.00
R8892:Cramp1l	UTSW	17	24983140	missense	probably damaging	1.00
R8894:Cramp1l	UTSW	17	24983140	missense	probably damaging	1.00
R8937:Cramp1l	UTSW	17	24983982	missense	probably damaging	0.99
R8941:Cramp1l	UTSW	17	24983140	missense	probably damaging	1.00
R9029:Cramp1l	UTSW	17	25013910	missense	probably damaging	1.00
R9047:Cramp1l	UTSW	17	24979629	missense	possibly damaging	0.90
R9149:Cramp1l	UTSW	17	24968946	missense	probably damaging	0.99
R9262:Cramp1l	UTSW	17	25013946	missense	probably damaging	0.99
R9460:Cramp1l	UTSW	17	25003307	missense	probably damaging	1.00
R9614:Cramp1l	UTSW	17	24982809	missense	probably damaging	1.00
R9615:Cramp1l	UTSW	17	24982809	missense	probably damaging	1.00
R9651:Cramp1l	UTSW	17	24982809	missense	probably damaging	1.00
R9652:Cramp1l	UTSW	17	24982809	missense	probably damaging	1.00
R9653:Cramp1l	UTSW	17	24982809	missense	probably damaging	1.00
R9665:Cramp1l	UTSW	17	24977571	missense	probably damaging	1.00
R9753:Cramp1l	UTSW	17	24972346	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- GTAGTGCAAGTAGTTCCGAGGCAG -3'
(R):5'- TGGTGATGCTTTCGATGCTCACAG -3'

Sequencing Primer
(F):5'- GAGGCAGGACTCTCTACCTAAG -3'
(R):5'- GGAGCTGAATATGCTATAGATCCCC -3'

Posted On

2014-04-24