Mutagenetix > Incidental Mutations

Incidental Mutation 'R1611:Taf4b'

176829

Institutional Source

Beutler Lab

Gene Symbol

Taf4b

Ensembl Gene

ENSMUSG00000054321

Gene Name

TATA-box binding protein associated factor 4b

Synonyms

Taf2c2, TAFII105, 2610524B04Rik, 105kDa, 4932409F03Rik

MMRRC Submission

039648-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.401) question?

Stock #

R1611 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

14783245-14900359 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 14844469 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 766 (E766V)

Ref Sequence

ENSEMBL: ENSMUSP00000126909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169862]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000169862
AA Change: E766V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126909
Gene: ENSMUSG00000054321
AA Change: E766V

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
low complexity region	185	196	N/A	INTRINSIC
Pfam:TAFH	257	348	5.3e-39	PFAM
low complexity region	359	376	N/A	INTRINSIC
low complexity region	412	422	N/A	INTRINSIC
Pfam:TAF4	610	852	4e-72	PFAM

Meta Mutation Damage Score

0.6075

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.2%
20x: 88.9%

Validation Efficiency

97% (75/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TATA binding protein (TBP) and TBP-associated factors (TAFs) participate in the formation of the TFIID protein complex, which is involved in initiation of transcription of genes by RNA polymerase II. This gene encodes a cell type-specific TAF that may be responsible for mediating transcription by a subset of activators in B cells. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation are infertile due to a granulosa cell defect preventing normal follicle formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730559C18Rik	G	A	1: 136,216,117	P527L	probably damaging	Het
Acsl6	A	T	11: 54,325,564	I186F	possibly damaging	Het
Actr6	T	A	10: 89,732,202	K14*	probably null	Het
Adgrv1	A	T	13: 81,559,117	V1390E	probably damaging	Het
Akap1	C	T	11: 88,845,278	R186K	probably benign	Het
Alg10b	T	A	15: 90,225,781	V99D	probably damaging	Het
Atp2c1	C	T	9: 105,442,852	G407S	probably damaging	Het
Atp9a	T	C	2: 168,673,569	M401V	probably damaging	Het
Auh	G	A	13: 52,835,496	P308L	probably benign	Het
Bclaf1	T	C	10: 20,323,252		probably benign	Het
Bcr	T	A	10: 75,125,202		probably null	Het
Bivm	T	C	1: 44,126,747	I119T	possibly damaging	Het
Cacna1h	A	G	17: 25,381,471	I1632T	probably damaging	Het
Capn9	G	A	8: 124,611,512	V537M	possibly damaging	Het
Cdk11b	G	A	4: 155,641,575		probably benign	Het
Cdk18	T	A	1: 132,122,375	I21F	probably damaging	Het
Cep85l	T	C	10: 53,348,681	T271A	probably benign	Het
Chrm5	T	C	2: 112,479,187	N528S	possibly damaging	Het
Cpsf6	T	A	10: 117,361,828		probably benign	Het
Cpt1c	T	C	7: 44,960,112	T689A	probably benign	Het
D030068K23Rik	T	C	8: 109,249,303	Y64C	unknown	Het
Ddb1	T	A	19: 10,612,888	C260S	probably damaging	Het
Ddb1	T	A	19: 10,626,764		probably null	Het
Ddx58	T	C	4: 40,223,862	Y339C	probably damaging	Het
Depdc5	C	A	5: 32,990,953	Q1478K	probably damaging	Het
Diaph1	A	C	18: 37,900,702	M247R	unknown	Het
Dusp8	T	C	7: 142,082,957	S299G	probably benign	Het
Erbb4	C	A	1: 68,040,388	G1178C	probably damaging	Het
Exoc7	A	T	11: 116,295,265	I370N	possibly damaging	Het
Fam120a	G	T	13: 48,885,743	A979E	possibly damaging	Het
Gm12353	T	A	4: 19,631,843	Y27*	probably null	Het
Gnl1	C	T	17: 35,987,549	T395I	probably damaging	Het
Hpse2	G	A	19: 42,789,065	T554I	probably damaging	Het
Hsd17b11	T	C	5: 104,009,899	I116V	probably benign	Het
Kif24	A	T	4: 41,423,552	V233E	probably benign	Het
Klhl5	A	G	5: 65,164,649	T673A	probably benign	Het
Kmt2c	C	A	5: 25,359,311		probably null	Het
Lipg	T	C	18: 74,948,059	N317S	possibly damaging	Het
Lpin1	A	T	12: 16,577,218	L109Q	probably null	Het
Lyst	A	G	13: 13,634,897	E384G	probably damaging	Het
Micalcl	T	A	7: 112,381,464	I105N	probably damaging	Het
Muc4	C	T	16: 32,750,986	T288I	possibly damaging	Het
Naa35	G	T	13: 59,628,933	R574L	probably benign	Het
Ncor2	T	C	5: 125,110,020		probably benign	Het
Nedd9	T	A	13: 41,316,930	D249V	probably benign	Het
Nsg1	T	A	5: 38,138,716	K38*	probably null	Het
Nup155	T	A	15: 8,130,160	D518E	probably damaging	Het
Olfr152	T	A	2: 87,782,624	I28N	probably benign	Het
Ovol1	T	A	19: 5,551,070	H231L	probably damaging	Het
Parg	A	G	14: 32,238,570	I586V	probably damaging	Het
Pde7b	T	C	10: 20,434,490	N242S	probably benign	Het
Pias3	T	A	3: 96,699,697		probably null	Het
Pramef12	A	T	4: 144,392,812	V395E	probably benign	Het
Ptprf	A	G	4: 118,236,233	V404A	probably benign	Het
Rnf145	T	C	11: 44,551,798	L259P	probably damaging	Het
Rps6ka5	C	G	12: 100,570,852	V540L	possibly damaging	Het
Ryr3	C	T	2: 112,653,505	D3966N	possibly damaging	Het
Samd9l	A	T	6: 3,373,771	S1163R	probably benign	Het
Serpinb9g	T	C	13: 33,492,874	I213T	possibly damaging	Het
Sil1	A	T	18: 35,269,088	V331E	possibly damaging	Het
Ski	A	G	4: 155,159,938	F410S	probably damaging	Het
Slc25a25	C	T	2: 32,420,379	E123K	probably damaging	Het
Slfnl1	A	G	4: 120,533,377	E75G	probably benign	Het
Sp1	T	A	15: 102,430,935	I436N	probably damaging	Het
Tgfbr1	A	G	4: 47,396,526	Y180C	probably damaging	Het
Ube4a	T	C	9: 44,956,737		probably benign	Het
Vmn2r1	T	A	3: 64,104,537	C606*	probably null	Het
Wdr63	T	C	3: 146,095,358	Y115C	probably damaging	Het
Zfp341	C	A	2: 154,645,703	H702Q	probably damaging	Het

Other mutations in Taf4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01658:Taf4b	APN	18	14844420	missense	probably damaging	1.00
IGL01755:Taf4b	APN	18	14897985	missense	probably benign
IGL01755:Taf4b	APN	18	14897986	missense	probably benign	0.13
IGL02049:Taf4b	APN	18	14830139	missense	probably benign	0.00
IGL02650:Taf4b	APN	18	14841983	nonsense	probably null
IGL03078:Taf4b	APN	18	14813554	missense	possibly damaging	0.48
IGL03169:Taf4b	APN	18	14821535	missense	probably damaging	1.00
IGL03261:Taf4b	APN	18	14821528	missense	probably benign
adirondack	UTSW	18	14804578	missense	probably null	0.16
R0266:Taf4b	UTSW	18	14813077	splice site	probably benign
R0385:Taf4b	UTSW	18	14783760	missense	probably benign	0.00
R1015:Taf4b	UTSW	18	14813098	missense	probably damaging	1.00
R1054:Taf4b	UTSW	18	14821473	missense	probably benign	0.00
R1416:Taf4b	UTSW	18	14821427	splice site	probably benign
R1435:Taf4b	UTSW	18	14807409	missense	probably damaging	1.00
R1609:Taf4b	UTSW	18	14835881	missense	probably damaging	1.00
R1906:Taf4b	UTSW	18	14822102	missense	probably benign	0.00
R2038:Taf4b	UTSW	18	14807399	missense	probably damaging	1.00
R2890:Taf4b	UTSW	18	14804792	missense	probably damaging	1.00
R4527:Taf4b	UTSW	18	14821442	missense	probably damaging	1.00
R4559:Taf4b	UTSW	18	14813526	missense	probably damaging	1.00
R4773:Taf4b	UTSW	18	14804520	missense	probably benign	0.30
R4857:Taf4b	UTSW	18	14804578	missense	probably null	0.16
R4946:Taf4b	UTSW	18	14813542	missense	probably damaging	1.00
R4984:Taf4b	UTSW	18	14835816	missense	probably damaging	1.00
R4994:Taf4b	UTSW	18	14898043	missense	probably damaging	0.99
R5010:Taf4b	UTSW	18	14822172	missense	possibly damaging	0.59
R5155:Taf4b	UTSW	18	14830095	missense	probably benign	0.07
R5874:Taf4b	UTSW	18	14804554	missense	probably benign
R6079:Taf4b	UTSW	18	14822198	missense	possibly damaging	0.75
R6303:Taf4b	UTSW	18	14807355	missense	probably damaging	1.00
R6304:Taf4b	UTSW	18	14807355	missense	probably damaging	1.00
R6372:Taf4b	UTSW	18	14804733	missense	probably damaging	1.00
R6972:Taf4b	UTSW	18	14813347	missense	possibly damaging	0.86
R7538:Taf4b	UTSW	18	14813545	missense	probably damaging	1.00
R7790:Taf4b	UTSW	18	14813274	missense	probably damaging	1.00
R8021:Taf4b	UTSW	18	14804524	missense	probably damaging	1.00
R8072:Taf4b	UTSW	18	14821528	missense	probably benign
R8075:Taf4b	UTSW	18	14783692	missense	possibly damaging	0.58
R8145:Taf4b	UTSW	18	14830028	missense	probably damaging	1.00
R8221:Taf4b	UTSW	18	14898049	missense	probably damaging	1.00
R8320:Taf4b	UTSW	18	14783692	missense	possibly damaging	0.58
R8509:Taf4b	UTSW	18	14898055	missense	probably damaging	1.00
R8535:Taf4b	UTSW	18	14822138	missense	probably damaging	0.99
R8772:Taf4b	UTSW	18	14835852	missense	probably damaging	1.00
R8805:Taf4b	UTSW	18	14813428	missense	possibly damaging	0.65
R8874:Taf4b	UTSW	18	14830070	missense	probably benign	0.39
R9155:Taf4b	UTSW	18	14813239	missense	probably benign	0.00
R9254:Taf4b	UTSW	18	14813374	missense	probably damaging	0.98
R9338:Taf4b	UTSW	18	14821498	missense	probably benign	0.00
R9379:Taf4b	UTSW	18	14813374	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GCCATGTTCCAGCATGAACAATGTC -3'
(R):5'- TTGAAGTACTGCCCTTGCCTCCAG -3'

Sequencing Primer
(F):5'- CTTGACTAGACCTGACTGACATTG -3'
(R):5'- GCCTCCAGCAGTTCCTG -3'

Posted On

2014-04-24