Incidental Mutation 'R1611:Taf4b'
ID 176829
Institutional Source Beutler Lab
Gene Symbol Taf4b
Ensembl Gene ENSMUSG00000054321
Gene Name TATA-box binding protein associated factor 4b
Synonyms 4932409F03Rik, TAFII105, Taf2c2, 2610524B04Rik, 105kDa
MMRRC Submission 039648-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.439) question?
Stock # R1611 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 14916302-15033416 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 14977526 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 766 (E766V)
Ref Sequence ENSEMBL: ENSMUSP00000126909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169862]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000169862
AA Change: E766V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126909
Gene: ENSMUSG00000054321
AA Change: E766V

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 185 196 N/A INTRINSIC
Pfam:TAFH 257 348 5.3e-39 PFAM
low complexity region 359 376 N/A INTRINSIC
low complexity region 412 422 N/A INTRINSIC
Pfam:TAF4 610 852 4e-72 PFAM
Meta Mutation Damage Score 0.6075 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TATA binding protein (TBP) and TBP-associated factors (TAFs) participate in the formation of the TFIID protein complex, which is involved in initiation of transcription of genes by RNA polymerase II. This gene encodes a cell type-specific TAF that may be responsible for mediating transcription by a subset of activators in B cells. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation are infertile due to a granulosa cell defect preventing normal follicle formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A T 11: 54,216,390 (GRCm39) I186F possibly damaging Het
Actr6 T A 10: 89,568,064 (GRCm39) K14* probably null Het
Adgrv1 A T 13: 81,707,236 (GRCm39) V1390E probably damaging Het
Akap1 C T 11: 88,736,104 (GRCm39) R186K probably benign Het
Alg10b T A 15: 90,109,984 (GRCm39) V99D probably damaging Het
Atp2c1 C T 9: 105,320,051 (GRCm39) G407S probably damaging Het
Atp9a T C 2: 168,515,489 (GRCm39) M401V probably damaging Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
Bclaf1 T C 10: 20,198,998 (GRCm39) probably benign Het
Bcr T A 10: 74,961,034 (GRCm39) probably null Het
Bivm T C 1: 44,165,907 (GRCm39) I119T possibly damaging Het
Cacna1h A G 17: 25,600,445 (GRCm39) I1632T probably damaging Het
Capn9 G A 8: 125,338,251 (GRCm39) V537M possibly damaging Het
Cdk11b G A 4: 155,726,032 (GRCm39) probably benign Het
Cdk18 T A 1: 132,050,113 (GRCm39) I21F probably damaging Het
Cep85l T C 10: 53,224,777 (GRCm39) T271A probably benign Het
Chrm5 T C 2: 112,309,532 (GRCm39) N528S possibly damaging Het
Cpsf6 T A 10: 117,197,733 (GRCm39) probably benign Het
Cpt1c T C 7: 44,609,536 (GRCm39) T689A probably benign Het
D030068K23Rik T C 8: 109,975,935 (GRCm39) Y64C unknown Het
Ddb1 T A 19: 10,604,128 (GRCm39) probably null Het
Ddb1 T A 19: 10,590,252 (GRCm39) C260S probably damaging Het
Depdc5 C A 5: 33,148,297 (GRCm39) Q1478K probably damaging Het
Diaph1 A C 18: 38,033,755 (GRCm39) M247R unknown Het
Dnai3 T C 3: 145,801,113 (GRCm39) Y115C probably damaging Het
Dusp8 T C 7: 141,636,694 (GRCm39) S299G probably benign Het
Erbb4 C A 1: 68,079,547 (GRCm39) G1178C probably damaging Het
Exoc7 A T 11: 116,186,091 (GRCm39) I370N possibly damaging Het
Fam120a G T 13: 49,039,219 (GRCm39) A979E possibly damaging Het
Gm12353 T A 4: 19,631,843 (GRCm39) Y27* probably null Het
Gnl1 C T 17: 36,298,441 (GRCm39) T395I probably damaging Het
Hpse2 G A 19: 42,777,504 (GRCm39) T554I probably damaging Het
Hsd17b11 T C 5: 104,157,765 (GRCm39) I116V probably benign Het
Inava G A 1: 136,143,855 (GRCm39) P527L probably damaging Het
Kif24 A T 4: 41,423,552 (GRCm39) V233E probably benign Het
Klhl5 A G 5: 65,321,992 (GRCm39) T673A probably benign Het
Kmt2c C A 5: 25,564,309 (GRCm39) probably null Het
Lipg T C 18: 75,081,130 (GRCm39) N317S possibly damaging Het
Lpin1 A T 12: 16,627,219 (GRCm39) L109Q probably null Het
Lyst A G 13: 13,809,482 (GRCm39) E384G probably damaging Het
Mical2 T A 7: 111,980,671 (GRCm39) I105N probably damaging Het
Muc4 C T 16: 32,569,804 (GRCm39) T288I possibly damaging Het
Naa35 G T 13: 59,776,747 (GRCm39) R574L probably benign Het
Ncor2 T C 5: 125,187,084 (GRCm39) probably benign Het
Nedd9 T A 13: 41,470,406 (GRCm39) D249V probably benign Het
Nsg1 T A 5: 38,296,060 (GRCm39) K38* probably null Het
Nup155 T A 15: 8,159,644 (GRCm39) D518E probably damaging Het
Or5i1 T A 2: 87,612,968 (GRCm39) I28N probably benign Het
Ovol1 T A 19: 5,601,098 (GRCm39) H231L probably damaging Het
Parg A G 14: 31,960,527 (GRCm39) I586V probably damaging Het
Pde7b T C 10: 20,310,236 (GRCm39) N242S probably benign Het
Pias3 T A 3: 96,607,013 (GRCm39) probably null Het
Pramel13 A T 4: 144,119,382 (GRCm39) V395E probably benign Het
Ptprf A G 4: 118,093,430 (GRCm39) V404A probably benign Het
Rigi T C 4: 40,223,862 (GRCm39) Y339C probably damaging Het
Rnf145 T C 11: 44,442,625 (GRCm39) L259P probably damaging Het
Rps6ka5 C G 12: 100,537,111 (GRCm39) V540L possibly damaging Het
Ryr3 C T 2: 112,483,850 (GRCm39) D3966N possibly damaging Het
Samd9l A T 6: 3,373,771 (GRCm39) S1163R probably benign Het
Serpinb9g T C 13: 33,676,857 (GRCm39) I213T possibly damaging Het
Sil1 A T 18: 35,402,141 (GRCm39) V331E possibly damaging Het
Ski A G 4: 155,244,395 (GRCm39) F410S probably damaging Het
Slc25a25 C T 2: 32,310,391 (GRCm39) E123K probably damaging Het
Slfnl1 A G 4: 120,390,574 (GRCm39) E75G probably benign Het
Sp1 T A 15: 102,339,370 (GRCm39) I436N probably damaging Het
Tgfbr1 A G 4: 47,396,526 (GRCm39) Y180C probably damaging Het
Ube4a T C 9: 44,868,035 (GRCm39) probably benign Het
Vmn2r1 T A 3: 64,011,958 (GRCm39) C606* probably null Het
Zfp341 C A 2: 154,487,623 (GRCm39) H702Q probably damaging Het
Other mutations in Taf4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01658:Taf4b APN 18 14,977,477 (GRCm39) missense probably damaging 1.00
IGL01755:Taf4b APN 18 15,031,043 (GRCm39) missense probably benign 0.13
IGL01755:Taf4b APN 18 15,031,042 (GRCm39) missense probably benign
IGL02049:Taf4b APN 18 14,963,196 (GRCm39) missense probably benign 0.00
IGL02650:Taf4b APN 18 14,975,040 (GRCm39) nonsense probably null
IGL03078:Taf4b APN 18 14,946,611 (GRCm39) missense possibly damaging 0.48
IGL03169:Taf4b APN 18 14,954,592 (GRCm39) missense probably damaging 1.00
IGL03261:Taf4b APN 18 14,954,585 (GRCm39) missense probably benign
adirondack UTSW 18 14,937,635 (GRCm39) missense probably null 0.16
R0266:Taf4b UTSW 18 14,946,134 (GRCm39) splice site probably benign
R0385:Taf4b UTSW 18 14,916,817 (GRCm39) missense probably benign 0.00
R1015:Taf4b UTSW 18 14,946,155 (GRCm39) missense probably damaging 1.00
R1054:Taf4b UTSW 18 14,954,530 (GRCm39) missense probably benign 0.00
R1416:Taf4b UTSW 18 14,954,484 (GRCm39) splice site probably benign
R1435:Taf4b UTSW 18 14,940,466 (GRCm39) missense probably damaging 1.00
R1609:Taf4b UTSW 18 14,968,938 (GRCm39) missense probably damaging 1.00
R1906:Taf4b UTSW 18 14,955,159 (GRCm39) missense probably benign 0.00
R2038:Taf4b UTSW 18 14,940,456 (GRCm39) missense probably damaging 1.00
R2890:Taf4b UTSW 18 14,937,849 (GRCm39) missense probably damaging 1.00
R4527:Taf4b UTSW 18 14,954,499 (GRCm39) missense probably damaging 1.00
R4559:Taf4b UTSW 18 14,946,583 (GRCm39) missense probably damaging 1.00
R4773:Taf4b UTSW 18 14,937,577 (GRCm39) missense probably benign 0.30
R4857:Taf4b UTSW 18 14,937,635 (GRCm39) missense probably null 0.16
R4946:Taf4b UTSW 18 14,946,599 (GRCm39) missense probably damaging 1.00
R4984:Taf4b UTSW 18 14,968,873 (GRCm39) missense probably damaging 1.00
R4994:Taf4b UTSW 18 15,031,100 (GRCm39) missense probably damaging 0.99
R5010:Taf4b UTSW 18 14,955,229 (GRCm39) missense possibly damaging 0.59
R5155:Taf4b UTSW 18 14,963,152 (GRCm39) missense probably benign 0.07
R5874:Taf4b UTSW 18 14,937,611 (GRCm39) missense probably benign
R6079:Taf4b UTSW 18 14,955,255 (GRCm39) missense possibly damaging 0.75
R6303:Taf4b UTSW 18 14,940,412 (GRCm39) missense probably damaging 1.00
R6304:Taf4b UTSW 18 14,940,412 (GRCm39) missense probably damaging 1.00
R6372:Taf4b UTSW 18 14,937,790 (GRCm39) missense probably damaging 1.00
R6972:Taf4b UTSW 18 14,946,404 (GRCm39) missense possibly damaging 0.86
R7538:Taf4b UTSW 18 14,946,602 (GRCm39) missense probably damaging 1.00
R7790:Taf4b UTSW 18 14,946,331 (GRCm39) missense probably damaging 1.00
R8021:Taf4b UTSW 18 14,937,581 (GRCm39) missense probably damaging 1.00
R8072:Taf4b UTSW 18 14,954,585 (GRCm39) missense probably benign
R8075:Taf4b UTSW 18 14,916,749 (GRCm39) missense possibly damaging 0.58
R8145:Taf4b UTSW 18 14,963,085 (GRCm39) missense probably damaging 1.00
R8221:Taf4b UTSW 18 15,031,106 (GRCm39) missense probably damaging 1.00
R8320:Taf4b UTSW 18 14,916,749 (GRCm39) missense possibly damaging 0.58
R8509:Taf4b UTSW 18 15,031,112 (GRCm39) missense probably damaging 1.00
R8535:Taf4b UTSW 18 14,955,195 (GRCm39) missense probably damaging 0.99
R8772:Taf4b UTSW 18 14,968,909 (GRCm39) missense probably damaging 1.00
R8805:Taf4b UTSW 18 14,946,485 (GRCm39) missense possibly damaging 0.65
R8874:Taf4b UTSW 18 14,963,127 (GRCm39) missense probably benign 0.39
R9155:Taf4b UTSW 18 14,946,296 (GRCm39) missense probably benign 0.00
R9254:Taf4b UTSW 18 14,946,431 (GRCm39) missense probably damaging 0.98
R9338:Taf4b UTSW 18 14,954,555 (GRCm39) missense probably benign 0.00
R9379:Taf4b UTSW 18 14,946,431 (GRCm39) missense probably damaging 0.98
R9630:Taf4b UTSW 18 14,930,077 (GRCm39) missense probably damaging 0.96
R9686:Taf4b UTSW 18 14,932,215 (GRCm39) missense possibly damaging 0.87
R9801:Taf4b UTSW 18 14,932,235 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCATGTTCCAGCATGAACAATGTC -3'
(R):5'- TTGAAGTACTGCCCTTGCCTCCAG -3'

Sequencing Primer
(F):5'- CTTGACTAGACCTGACTGACATTG -3'
(R):5'- GCCTCCAGCAGTTCCTG -3'
Posted On 2014-04-24