Incidental Mutation 'R1612:Nav2'
ID176865
Institutional Source Beutler Lab
Gene Symbol Nav2
Ensembl Gene ENSMUSG00000052512
Gene Nameneuron navigator 2
SynonymsRainb1, HELAD1, Unc53H2, RAINB2, 5330421F07Rik, POMFIL2
MMRRC Submission 039649-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.496) question?
Stock #R1612 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location48908716-49610090 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49571211 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1715 (N1715K)
Ref Sequence ENSEMBL: ENSMUSP00000139045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064395] [ENSMUST00000183659] [ENSMUST00000184945]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064395
AA Change: N1715K

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067448
Gene: ENSMUSG00000052512
AA Change: N1715K

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183659
AA Change: N1654K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139309
Gene: ENSMUSG00000052512
AA Change: N1654K

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
CH 23 126 6.19e-16 SMART
low complexity region 141 149 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
coiled coil region 425 455 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
low complexity region 552 564 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
low complexity region 859 883 N/A INTRINSIC
low complexity region 886 906 N/A INTRINSIC
low complexity region 929 943 N/A INTRINSIC
low complexity region 1001 1013 N/A INTRINSIC
low complexity region 1282 1299 N/A INTRINSIC
low complexity region 1307 1324 N/A INTRINSIC
low complexity region 1356 1371 N/A INTRINSIC
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1465 1479 N/A INTRINSIC
low complexity region 1553 1567 N/A INTRINSIC
coiled coil region 1569 1656 N/A INTRINSIC
low complexity region 1728 1739 N/A INTRINSIC
coiled coil region 1780 1848 N/A INTRINSIC
AAA 2032 2186 1.69e-5 SMART
low complexity region 2343 2369 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184102
Predicted Effect probably damaging
Transcript: ENSMUST00000184945
AA Change: N1715K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139045
Gene: ENSMUSG00000052512
AA Change: N1715K

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Meta Mutation Damage Score 0.1844 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuron navigator gene family, which may play a role in cellular growth and migration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display impaired olfaction and hearing, increased latency in a hot plate test, degeneration of the optic nerve, decreased exploration in new environments, and weight loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik A G 3: 79,631,144 T66A probably benign Het
9930021J03Rik A G 19: 29,717,845 V1483A possibly damaging Het
Actb A G 5: 142,905,595 F31S probably damaging Het
Adamts7 T C 9: 90,188,697 S624P possibly damaging Het
Adh7 T C 3: 138,228,881 I355T possibly damaging Het
Arhgef40 A G 14: 52,004,081 E106G probably damaging Het
Cabp7 T C 11: 4,739,198 D149G probably damaging Het
Cass4 A T 2: 172,427,078 Q362L possibly damaging Het
Cd14 G A 18: 36,725,665 Q246* probably null Het
Cdr2l A C 11: 115,393,406 E189D probably benign Het
Col6a6 A G 9: 105,777,549 V991A probably damaging Het
Coq7 A G 7: 118,509,911 W305R unknown Het
Cracr2a G T 6: 127,603,929 G23* probably null Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Epcam T C 17: 87,639,938 L40P possibly damaging Het
Eps8 G A 6: 137,500,618 P531S probably benign Het
Faap100 C A 11: 120,377,088 L286F probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbn2 A T 18: 58,061,752 C1446S probably damaging Het
Fmo3 A G 1: 162,967,885 V127A probably damaging Het
Frem3 A G 8: 80,614,861 D1261G probably damaging Het
Gabbr1 A G 17: 37,070,669 Y775C probably damaging Het
Gbp11 G T 5: 105,326,596 Q405K possibly damaging Het
Gdi2 T A 13: 3,560,051 V260E probably benign Het
Glp2r C T 11: 67,742,207 V98M possibly damaging Het
Gm13741 T C 2: 87,656,087 Y278C probably damaging Het
Gm7732 G A 17: 21,129,915 noncoding transcript Het
Gnptab T A 10: 88,428,482 probably null Het
Hbs1l T G 10: 21,358,835 F596V probably damaging Het
Krt78 A T 15: 101,951,844 probably null Het
Krt83 A T 15: 101,488,211 L223Q probably benign Het
Lcmt2 T C 2: 121,139,120 Y274C probably damaging Het
Limd1 A G 9: 123,518,154 Y620C probably damaging Het
Lvrn G T 18: 46,894,703 A862S probably damaging Het
Map4k2 A G 19: 6,343,341 E206G probably damaging Het
Med16 A G 10: 79,899,245 S461P probably damaging Het
Mrfap1 C A 5: 36,796,362 A78S probably damaging Het
Mum1 T A 10: 80,233,055 probably benign Het
Ndc1 A G 4: 107,395,068 probably benign Het
Ngly1 G T 14: 16,290,867 G450* probably null Het
Olfr195 T C 16: 59,149,624 M258T probably benign Het
Olfr272 T A 4: 52,911,501 M98L probably benign Het
Pde3b T A 7: 114,519,556 Y643* probably null Het
Pdilt T G 7: 119,486,975 N506H possibly damaging Het
Pear1 C T 3: 87,751,853 probably null Het
Pfkp A T 13: 6,588,589 M582K probably damaging Het
Pigl T A 11: 62,512,994 F251I probably benign Het
Plk3 A G 4: 117,131,807 Y252H probably damaging Het
Prdx3 A G 19: 60,874,434 S12P possibly damaging Het
Prkag2 T C 5: 24,877,028 I96V probably benign Het
Rgs3 G A 4: 62,625,935 V146M probably damaging Het
Serpinh1 T C 7: 99,348,931 D164G probably damaging Het
Slc35d2 T C 13: 64,111,510 probably benign Het
Slc6a6 A G 6: 91,741,027 N316D probably damaging Het
Snx14 A T 9: 88,376,905 M973K possibly damaging Het
Sptan1 C G 2: 30,003,336 R1126G probably damaging Het
Stpg3 T C 2: 25,213,854 T157A probably benign Het
Tmem39b A T 4: 129,686,922 M259K possibly damaging Het
Tomm40l A T 1: 171,221,902 probably null Het
Tsen34 G T 7: 3,695,396 G180W probably damaging Het
Ube2l6 C T 2: 84,806,373 R54W probably damaging Het
Vdac1 A T 11: 52,384,070 T182S probably benign Het
Wdr3 T C 3: 100,151,199 probably benign Het
Wsb1 T A 11: 79,248,585 Q95L probably benign Het
Other mutations in Nav2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Nav2 APN 7 49571194 missense probably damaging 1.00
IGL01150:Nav2 APN 7 49452521 missense probably benign 0.17
IGL01649:Nav2 APN 7 49575729 missense probably damaging 1.00
IGL01662:Nav2 APN 7 49571209 missense probably damaging 1.00
IGL02297:Nav2 APN 7 49594229 missense probably damaging 0.98
IGL02313:Nav2 APN 7 49558773 missense probably damaging 0.99
IGL02441:Nav2 APN 7 49452512 missense probably damaging 1.00
IGL02472:Nav2 APN 7 49546041 missense probably damaging 1.00
IGL02477:Nav2 APN 7 49582875 missense probably damaging 0.99
IGL02725:Nav2 APN 7 49565095 missense probably damaging 1.00
IGL02944:Nav2 APN 7 49420256 missense probably damaging 0.99
IGL02953:Nav2 APN 7 49548423 missense probably damaging 1.00
IGL03105:Nav2 APN 7 49464879 missense probably damaging 1.00
IGL03234:Nav2 APN 7 49462008 missense possibly damaging 0.94
IGL03274:Nav2 APN 7 49362099 missense probably damaging 1.00
IGL03294:Nav2 APN 7 49491457 nonsense probably null
R0006:Nav2 UTSW 7 49453230 missense possibly damaging 0.50
R0070:Nav2 UTSW 7 49570714 missense probably damaging 1.00
R0113:Nav2 UTSW 7 49535953 missense probably damaging 1.00
R0306:Nav2 UTSW 7 49545903 missense probably benign 0.01
R0346:Nav2 UTSW 7 49604585 missense probably benign 0.11
R0539:Nav2 UTSW 7 49461938 missense probably damaging 1.00
R0669:Nav2 UTSW 7 49408683 missense probably damaging 1.00
R0785:Nav2 UTSW 7 49420333 missense probably benign 0.06
R0970:Nav2 UTSW 7 49584153 missense probably damaging 1.00
R1162:Nav2 UTSW 7 49536040 splice site probably benign
R1274:Nav2 UTSW 7 49604430 nonsense probably null
R1463:Nav2 UTSW 7 49535962 missense probably damaging 1.00
R1464:Nav2 UTSW 7 49362204 missense probably damaging 1.00
R1464:Nav2 UTSW 7 49362204 missense probably damaging 1.00
R1536:Nav2 UTSW 7 49545934 missense probably damaging 1.00
R1638:Nav2 UTSW 7 49452465 missense probably benign
R1731:Nav2 UTSW 7 49548174 missense probably damaging 1.00
R1734:Nav2 UTSW 7 49575720 missense probably damaging 1.00
R1865:Nav2 UTSW 7 49548195 missense possibly damaging 0.95
R1945:Nav2 UTSW 7 49464872 missense probably damaging 1.00
R1997:Nav2 UTSW 7 49548471 missense probably benign 0.16
R2061:Nav2 UTSW 7 49598897 splice site probably benign
R2117:Nav2 UTSW 7 49464580 missense probably benign 0.00
R2174:Nav2 UTSW 7 49452663 missense probably damaging 0.99
R2182:Nav2 UTSW 7 49597254 missense probably benign 0.38
R2251:Nav2 UTSW 7 49453277 missense probably damaging 1.00
R2283:Nav2 UTSW 7 49491404 missense probably damaging 1.00
R2343:Nav2 UTSW 7 49598817 missense possibly damaging 0.82
R2472:Nav2 UTSW 7 49408884 missense probably benign
R2568:Nav2 UTSW 7 49597564 missense probably damaging 1.00
R2656:Nav2 UTSW 7 49545942 missense probably damaging 1.00
R2964:Nav2 UTSW 7 49557032 missense probably damaging 1.00
R2966:Nav2 UTSW 7 49557032 missense probably damaging 1.00
R3817:Nav2 UTSW 7 49464562 missense probably benign 0.00
R3834:Nav2 UTSW 7 49545858 missense possibly damaging 0.91
R4207:Nav2 UTSW 7 49572298 splice site probably null
R4207:Nav2 UTSW 7 49597231 missense probably damaging 1.00
R4411:Nav2 UTSW 7 49398109 missense probably benign 0.37
R4413:Nav2 UTSW 7 49398109 missense probably benign 0.37
R4440:Nav2 UTSW 7 49552037 missense possibly damaging 0.86
R4440:Nav2 UTSW 7 49575263 splice site probably benign
R4454:Nav2 UTSW 7 49548544 splice site probably null
R4729:Nav2 UTSW 7 49452819 missense probably benign 0.17
R4801:Nav2 UTSW 7 49545852 missense possibly damaging 0.94
R4802:Nav2 UTSW 7 49545852 missense possibly damaging 0.94
R4824:Nav2 UTSW 7 49409001 intron probably benign
R4887:Nav2 UTSW 7 49548434 nonsense probably null
R4908:Nav2 UTSW 7 49604510 missense probably damaging 1.00
R4952:Nav2 UTSW 7 49304540 intron probably benign
R4965:Nav2 UTSW 7 49552877 nonsense probably null
R5169:Nav2 UTSW 7 49548483 nonsense probably null
R5224:Nav2 UTSW 7 49551725 missense probably benign 0.00
R5249:Nav2 UTSW 7 49535913 missense probably damaging 1.00
R5285:Nav2 UTSW 7 49548234 missense probably damaging 1.00
R5314:Nav2 UTSW 7 49408692 small deletion probably benign
R5320:Nav2 UTSW 7 49491373 missense probably benign 0.00
R5377:Nav2 UTSW 7 49589160 missense probably benign 0.02
R5471:Nav2 UTSW 7 49548169 missense probably damaging 1.00
R5754:Nav2 UTSW 7 49557046 missense probably damaging 1.00
R5832:Nav2 UTSW 7 49548069 unclassified probably null
R5884:Nav2 UTSW 7 49597169 nonsense probably null
R5921:Nav2 UTSW 7 49304576 intron probably benign
R6180:Nav2 UTSW 7 49458167 missense probably benign 0.39
R6208:Nav2 UTSW 7 49564103 missense probably damaging 0.99
R6373:Nav2 UTSW 7 49453175 missense probably damaging 1.00
R6450:Nav2 UTSW 7 49594366 missense probably damaging 1.00
R6522:Nav2 UTSW 7 49597533 missense probably damaging 1.00
R6626:Nav2 UTSW 7 49594352 missense probably damaging 1.00
R6695:Nav2 UTSW 7 49464904 missense probably benign 0.04
R6705:Nav2 UTSW 7 49551916 missense probably damaging 1.00
R6842:Nav2 UTSW 7 49458169 missense possibly damaging 0.91
R6847:Nav2 UTSW 7 49491456 missense probably benign 0.14
R7287:Nav2 UTSW 7 49420328 missense probably benign 0.01
R7312:Nav2 UTSW 7 49461924 missense possibly damaging 0.55
R7315:Nav2 UTSW 7 49548289 missense possibly damaging 0.61
R7337:Nav2 UTSW 7 49551773 missense possibly damaging 0.56
R7366:Nav2 UTSW 7 49554203 splice site probably null
R7451:Nav2 UTSW 7 49552829 splice site probably null
R7545:Nav2 UTSW 7 49582857 missense probably damaging 1.00
R7706:Nav2 UTSW 7 49594319 missense probably benign 0.35
R7730:Nav2 UTSW 7 49572397 missense probably damaging 1.00
R7812:Nav2 UTSW 7 49597173 missense probably benign 0.13
X0023:Nav2 UTSW 7 49547899 missense possibly damaging 0.47
Z1177:Nav2 UTSW 7 49452761 missense possibly damaging 0.47
Z1177:Nav2 UTSW 7 49594223 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGATCCCTGTGACACTCCTTTGAC -3'
(R):5'- TGGAGCGAACTCACATACATGCCC -3'

Sequencing Primer
(F):5'- GTGACACTCCTTTGACACTGC -3'
(R):5'- GCCCAACAATTTGTTAAGGCAG -3'
Posted On2014-04-24