Incidental Mutation 'R1612:Serpinh1'
ID176866
Institutional Source Beutler Lab
Gene Symbol Serpinh1
Ensembl Gene ENSMUSG00000070436
Gene Nameserine (or cysteine) peptidase inhibitor, clade H, member 1
SynonymsHsp47, gp46, Cbp2, Serpinh2, Cbp1, colligin, J6
MMRRC Submission 039649-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1612 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location99345376-99353239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99348931 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 164 (D164G)
Ref Sequence ENSEMBL: ENSMUSP00000146969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094154] [ENSMUST00000169437] [ENSMUST00000207849] [ENSMUST00000207989] [ENSMUST00000208119] [ENSMUST00000208292] [ENSMUST00000208749]
Predicted Effect probably damaging
Transcript: ENSMUST00000094154
AA Change: D164G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091706
Gene: ENSMUSG00000070436
AA Change: D164G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 51 408 6.88e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169437
AA Change: D164G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126390
Gene: ENSMUSG00000070436
AA Change: D164G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 51 408 6.88e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207849
AA Change: D164G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000207989
Predicted Effect probably damaging
Transcript: ENSMUST00000208119
AA Change: D164G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000208292
Predicted Effect probably benign
Transcript: ENSMUST00000208749
AA Change: D164G

PolyPhen 2 Score 0.367 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.2484 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serpin superfamily of serine proteinase inhibitors. The encoded protein is localized to the endoplasmic reticulum and plays a role in collagen biosynthesis as a collagen-specific molecular chaperone. Autoantibodies to the encoded protein have been found in patients with rheumatoid arthritis. Expression of this gene may be a marker for cancer, and nucleotide polymorphisms in this gene may be associated with preterm birth caused by preterm premature rupture of membranes. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 9. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos before E11.5. Mice homozygous for a conditional allele activated in chondrocytes exhibit complete perinatal lethality, cleft palate, respiratory distress, abnormal chondocytes and bone formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik A G 3: 79,631,144 T66A probably benign Het
9930021J03Rik A G 19: 29,717,845 V1483A possibly damaging Het
Actb A G 5: 142,905,595 F31S probably damaging Het
Adamts7 T C 9: 90,188,697 S624P possibly damaging Het
Adh7 T C 3: 138,228,881 I355T possibly damaging Het
Arhgef40 A G 14: 52,004,081 E106G probably damaging Het
Cabp7 T C 11: 4,739,198 D149G probably damaging Het
Cass4 A T 2: 172,427,078 Q362L possibly damaging Het
Cd14 G A 18: 36,725,665 Q246* probably null Het
Cdr2l A C 11: 115,393,406 E189D probably benign Het
Col6a6 A G 9: 105,777,549 V991A probably damaging Het
Coq7 A G 7: 118,509,911 W305R unknown Het
Cracr2a G T 6: 127,603,929 G23* probably null Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Epcam T C 17: 87,639,938 L40P possibly damaging Het
Eps8 G A 6: 137,500,618 P531S probably benign Het
Faap100 C A 11: 120,377,088 L286F probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbn2 A T 18: 58,061,752 C1446S probably damaging Het
Fmo3 A G 1: 162,967,885 V127A probably damaging Het
Frem3 A G 8: 80,614,861 D1261G probably damaging Het
Gabbr1 A G 17: 37,070,669 Y775C probably damaging Het
Gbp11 G T 5: 105,326,596 Q405K possibly damaging Het
Gdi2 T A 13: 3,560,051 V260E probably benign Het
Glp2r C T 11: 67,742,207 V98M possibly damaging Het
Gm13741 T C 2: 87,656,087 Y278C probably damaging Het
Gm7732 G A 17: 21,129,915 noncoding transcript Het
Gnptab T A 10: 88,428,482 probably null Het
Hbs1l T G 10: 21,358,835 F596V probably damaging Het
Krt78 A T 15: 101,951,844 probably null Het
Krt83 A T 15: 101,488,211 L223Q probably benign Het
Lcmt2 T C 2: 121,139,120 Y274C probably damaging Het
Limd1 A G 9: 123,518,154 Y620C probably damaging Het
Lvrn G T 18: 46,894,703 A862S probably damaging Het
Map4k2 A G 19: 6,343,341 E206G probably damaging Het
Med16 A G 10: 79,899,245 S461P probably damaging Het
Mrfap1 C A 5: 36,796,362 A78S probably damaging Het
Mum1 T A 10: 80,233,055 probably benign Het
Nav2 T A 7: 49,571,211 N1715K probably damaging Het
Ndc1 A G 4: 107,395,068 probably benign Het
Ngly1 G T 14: 16,290,867 G450* probably null Het
Olfr195 T C 16: 59,149,624 M258T probably benign Het
Olfr272 T A 4: 52,911,501 M98L probably benign Het
Pde3b T A 7: 114,519,556 Y643* probably null Het
Pdilt T G 7: 119,486,975 N506H possibly damaging Het
Pear1 C T 3: 87,751,853 probably null Het
Pfkp A T 13: 6,588,589 M582K probably damaging Het
Pigl T A 11: 62,512,994 F251I probably benign Het
Plk3 A G 4: 117,131,807 Y252H probably damaging Het
Prdx3 A G 19: 60,874,434 S12P possibly damaging Het
Prkag2 T C 5: 24,877,028 I96V probably benign Het
Rgs3 G A 4: 62,625,935 V146M probably damaging Het
Slc35d2 T C 13: 64,111,510 probably benign Het
Slc6a6 A G 6: 91,741,027 N316D probably damaging Het
Snx14 A T 9: 88,376,905 M973K possibly damaging Het
Sptan1 C G 2: 30,003,336 R1126G probably damaging Het
Stpg3 T C 2: 25,213,854 T157A probably benign Het
Tmem39b A T 4: 129,686,922 M259K possibly damaging Het
Tomm40l A T 1: 171,221,902 probably null Het
Tsen34 G T 7: 3,695,396 G180W probably damaging Het
Ube2l6 C T 2: 84,806,373 R54W probably damaging Het
Vdac1 A T 11: 52,384,070 T182S probably benign Het
Wdr3 T C 3: 100,151,199 probably benign Het
Wsb1 T A 11: 79,248,585 Q95L probably benign Het
Other mutations in Serpinh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02405:Serpinh1 APN 7 99347334 missense possibly damaging 0.94
IGL02506:Serpinh1 APN 7 99346992 missense probably damaging 1.00
R0070:Serpinh1 UTSW 7 99349314 missense probably damaging 1.00
R0070:Serpinh1 UTSW 7 99349314 missense probably damaging 1.00
R0608:Serpinh1 UTSW 7 99349394 missense unknown
R1338:Serpinh1 UTSW 7 99348911 missense probably damaging 1.00
R1916:Serpinh1 UTSW 7 99349081 missense probably damaging 1.00
R2321:Serpinh1 UTSW 7 99346385 missense probably damaging 1.00
R2886:Serpinh1 UTSW 7 99349021 missense probably damaging 1.00
R4176:Serpinh1 UTSW 7 99346999 missense probably benign
R5860:Serpinh1 UTSW 7 99346364 missense probably damaging 1.00
R7345:Serpinh1 UTSW 7 99346356 missense probably damaging 0.99
R7884:Serpinh1 UTSW 7 99349288 missense probably benign 0.00
R8215:Serpinh1 UTSW 7 99346338 missense possibly damaging 0.58
R8309:Serpinh1 UTSW 7 99348944 missense possibly damaging 0.94
RF005:Serpinh1 UTSW 7 99346203 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCTTATCAGTAGCCCTGACTC -3'
(R):5'- AGAACATCCTCCTGTCACCCTTGG -3'

Sequencing Primer
(F):5'- TTTCCATAAGGAGAATCAAGCTCAGG -3'
(R):5'- GTCACTGGGTGGTAAAGCC -3'
Posted On2014-04-24