Incidental Mutation 'R1612:Arhgef40'
ID 176891
Institutional Source Beutler Lab
Gene Symbol Arhgef40
Ensembl Gene ENSMUSG00000004562
Gene Name Rho guanine nucleotide exchange factor 40
Synonyms E130112L23Rik
MMRRC Submission 039649-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.172) question?
Stock # R1612 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 52222176-52243708 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 52241538 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 106 (E106G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067549] [ENSMUST00000093813] [ENSMUST00000100639] [ENSMUST00000166169] [ENSMUST00000182061] [ENSMUST00000182909] [ENSMUST00000182760] [ENSMUST00000183208] [ENSMUST00000182905] [ENSMUST00000226522] [ENSMUST00000226964] [ENSMUST00000228580]
AlphaFold Q3UPH7
Predicted Effect probably benign
Transcript: ENSMUST00000067549
SMART Domains Protein: ENSMUSP00000068184
Gene: ENSMUSG00000049295

DomainStartEndE-ValueType
low complexity region 30 47 N/A INTRINSIC
ZnF_C2H2 61 83 6.23e-2 SMART
ZnF_C2H2 89 111 4.17e-3 SMART
low complexity region 113 146 N/A INTRINSIC
ZnF_C2H2 167 190 3.07e-1 SMART
ZnF_C2H2 193 216 1.51e0 SMART
low complexity region 229 276 N/A INTRINSIC
ZnF_C2H2 277 299 8.47e-4 SMART
ZnF_C2H2 305 327 1.38e-3 SMART
low complexity region 331 350 N/A INTRINSIC
low complexity region 354 379 N/A INTRINSIC
low complexity region 427 441 N/A INTRINSIC
ZnF_C2H2 501 523 3.63e-3 SMART
ZnF_C2H2 529 551 1.58e-3 SMART
low complexity region 560 570 N/A INTRINSIC
low complexity region 594 611 N/A INTRINSIC
low complexity region 637 648 N/A INTRINSIC
ZnF_C2H2 650 672 2.82e0 SMART
low complexity region 675 684 N/A INTRINSIC
low complexity region 695 714 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093813
AA Change: E1449G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091331
Gene: ENSMUSG00000004562
AA Change: E1449G

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 6.1e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100639
SMART Domains Protein: ENSMUSP00000098204
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 5.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166169
SMART Domains Protein: ENSMUSP00000126854
Gene: ENSMUSG00000049295

DomainStartEndE-ValueType
low complexity region 30 47 N/A INTRINSIC
ZnF_C2H2 61 83 6.23e-2 SMART
ZnF_C2H2 89 111 4.17e-3 SMART
low complexity region 113 146 N/A INTRINSIC
ZnF_C2H2 167 190 3.07e-1 SMART
ZnF_C2H2 193 216 1.51e0 SMART
low complexity region 229 276 N/A INTRINSIC
ZnF_C2H2 277 299 8.47e-4 SMART
ZnF_C2H2 305 327 1.38e-3 SMART
low complexity region 331 350 N/A INTRINSIC
low complexity region 354 379 N/A INTRINSIC
low complexity region 427 441 N/A INTRINSIC
ZnF_C2H2 501 523 3.63e-3 SMART
ZnF_C2H2 529 551 1.58e-3 SMART
low complexity region 560 570 N/A INTRINSIC
low complexity region 594 611 N/A INTRINSIC
low complexity region 637 648 N/A INTRINSIC
ZnF_C2H2 650 672 2.82e0 SMART
low complexity region 675 684 N/A INTRINSIC
low complexity region 695 714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182061
SMART Domains Protein: ENSMUSP00000138128
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.7e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182217
AA Change: E46G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000182667
AA Change: E106G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000182909
AA Change: E1449G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138635
Gene: ENSMUSG00000004562
AA Change: E1449G

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182760
AA Change: E1458G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138125
Gene: ENSMUSG00000004562
AA Change: E1458G

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 782 801 N/A INTRINSIC
low complexity region 894 923 N/A INTRINSIC
low complexity region 967 1005 N/A INTRINSIC
Pfam:RhoGEF 1096 1256 5.9e-9 PFAM
PH 1273 1381 3.97e-8 SMART
low complexity region 1412 1433 N/A INTRINSIC
low complexity region 1487 1500 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182931
Predicted Effect probably benign
Transcript: ENSMUST00000182828
Predicted Effect probably benign
Transcript: ENSMUST00000183208
SMART Domains Protein: ENSMUSP00000138354
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182905
SMART Domains Protein: ENSMUSP00000138797
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
SCOP:d1kz7a1 1073 1162 4e-7 SMART
Blast:RhoGEF 1087 1157 1e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000226522
Predicted Effect probably benign
Transcript: ENSMUST00000226964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226474
Predicted Effect probably benign
Transcript: ENSMUST00000228580
Meta Mutation Damage Score 0.2332 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to guanosine nucleotide exchange factors for Rho GTPases. The encoded protein contains in its C-terminus a GEF domain involved in exchange activity and a pleckstrin homology domain. Alternatively spliced transcripts that encode different proteins have been described. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik A G 3: 79,538,451 (GRCm39) T66A probably benign Het
Actb A G 5: 142,891,350 (GRCm39) F31S probably damaging Het
Adamts7 T C 9: 90,070,750 (GRCm39) S624P possibly damaging Het
Adh7 T C 3: 137,934,642 (GRCm39) I355T possibly damaging Het
Brd10 A G 19: 29,695,245 (GRCm39) V1483A possibly damaging Het
Cabp7 T C 11: 4,689,198 (GRCm39) D149G probably damaging Het
Cass4 A T 2: 172,268,998 (GRCm39) Q362L possibly damaging Het
Cd14 G A 18: 36,858,718 (GRCm39) Q246* probably null Het
Cdr2l A C 11: 115,284,232 (GRCm39) E189D probably benign Het
Col6a6 A G 9: 105,654,748 (GRCm39) V991A probably damaging Het
Coq7 A G 7: 118,109,134 (GRCm39) W305R unknown Het
Cracr2a G T 6: 127,580,892 (GRCm39) G23* probably null Het
Dclk2 C T 3: 86,712,946 (GRCm39) R503Q possibly damaging Het
Epcam T C 17: 87,947,366 (GRCm39) L40P possibly damaging Het
Eps8 G A 6: 137,477,616 (GRCm39) P531S probably benign Het
Faap100 C A 11: 120,267,914 (GRCm39) L286F probably damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fbn2 A T 18: 58,194,824 (GRCm39) C1446S probably damaging Het
Fmo3 A G 1: 162,795,454 (GRCm39) V127A probably damaging Het
Frem3 A G 8: 81,341,490 (GRCm39) D1261G probably damaging Het
Gabbr1 A G 17: 37,381,561 (GRCm39) Y775C probably damaging Het
Gbp11 G T 5: 105,474,462 (GRCm39) Q405K possibly damaging Het
Gdi2 T A 13: 3,610,051 (GRCm39) V260E probably benign Het
Glp2r C T 11: 67,633,033 (GRCm39) V98M possibly damaging Het
Gm13741 T C 2: 87,486,431 (GRCm39) Y278C probably damaging Het
Gm7732 G A 17: 21,350,177 (GRCm39) noncoding transcript Het
Gnptab T A 10: 88,264,344 (GRCm39) probably null Het
Hbs1l T G 10: 21,234,734 (GRCm39) F596V probably damaging Het
Krt78 A T 15: 101,860,279 (GRCm39) probably null Het
Krt87 A T 15: 101,386,092 (GRCm39) L223Q probably benign Het
Lcmt2 T C 2: 120,969,601 (GRCm39) Y274C probably damaging Het
Limd1 A G 9: 123,347,219 (GRCm39) Y620C probably damaging Het
Lvrn G T 18: 47,027,770 (GRCm39) A862S probably damaging Het
Map4k2 A G 19: 6,393,371 (GRCm39) E206G probably damaging Het
Med16 A G 10: 79,735,079 (GRCm39) S461P probably damaging Het
Mrfap1 C A 5: 36,953,706 (GRCm39) A78S probably damaging Het
Nav2 T A 7: 49,220,959 (GRCm39) N1715K probably damaging Het
Ndc1 A G 4: 107,252,265 (GRCm39) probably benign Het
Ngly1 G T 14: 16,290,867 (GRCm38) G450* probably null Het
Or13c25 T A 4: 52,911,501 (GRCm39) M98L probably benign Het
Or5k3 T C 16: 58,969,987 (GRCm39) M258T probably benign Het
Pde3b T A 7: 114,118,791 (GRCm39) Y643* probably null Het
Pdilt T G 7: 119,086,198 (GRCm39) N506H possibly damaging Het
Pear1 C T 3: 87,659,160 (GRCm39) probably null Het
Pfkp A T 13: 6,638,625 (GRCm39) M582K probably damaging Het
Pigl T A 11: 62,403,820 (GRCm39) F251I probably benign Het
Plk3 A G 4: 116,989,004 (GRCm39) Y252H probably damaging Het
Prdx3 A G 19: 60,862,872 (GRCm39) S12P possibly damaging Het
Prkag2 T C 5: 25,082,026 (GRCm39) I96V probably benign Het
Pwwp3a T A 10: 80,068,889 (GRCm39) probably benign Het
Rgs3 G A 4: 62,544,172 (GRCm39) V146M probably damaging Het
Serpinh1 T C 7: 98,998,138 (GRCm39) D164G probably damaging Het
Slc35d2 T C 13: 64,259,324 (GRCm39) probably benign Het
Slc6a6 A G 6: 91,718,008 (GRCm39) N316D probably damaging Het
Snx14 A T 9: 88,258,958 (GRCm39) M973K possibly damaging Het
Sptan1 C G 2: 29,893,348 (GRCm39) R1126G probably damaging Het
Stpg3 T C 2: 25,103,866 (GRCm39) T157A probably benign Het
Tmem39b A T 4: 129,580,715 (GRCm39) M259K possibly damaging Het
Tomm40l A T 1: 171,049,471 (GRCm39) probably null Het
Tsen34 G T 7: 3,698,395 (GRCm39) G180W probably damaging Het
Ube2l6 C T 2: 84,636,717 (GRCm39) R54W probably damaging Het
Vdac1 A T 11: 52,274,897 (GRCm39) T182S probably benign Het
Wdr3 T C 3: 100,058,515 (GRCm39) probably benign Het
Wsb1 T A 11: 79,139,411 (GRCm39) Q95L probably benign Het
Other mutations in Arhgef40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Arhgef40 APN 14 52,226,417 (GRCm39) missense probably damaging 1.00
IGL00848:Arhgef40 APN 14 52,224,884 (GRCm39) missense probably damaging 1.00
IGL00966:Arhgef40 APN 14 52,229,155 (GRCm39) critical splice donor site probably null
IGL01123:Arhgef40 APN 14 52,231,803 (GRCm39) missense probably damaging 0.99
IGL02110:Arhgef40 APN 14 52,226,862 (GRCm39) missense probably damaging 1.00
IGL02490:Arhgef40 APN 14 52,226,652 (GRCm39) missense probably damaging 0.99
IGL02505:Arhgef40 APN 14 52,238,320 (GRCm39) missense probably damaging 1.00
IGL02636:Arhgef40 APN 14 52,234,865 (GRCm39) missense probably damaging 1.00
R0200:Arhgef40 UTSW 14 52,234,431 (GRCm39) missense probably damaging 0.99
R0496:Arhgef40 UTSW 14 52,242,364 (GRCm39) unclassified probably benign
R0608:Arhgef40 UTSW 14 52,234,431 (GRCm39) missense probably damaging 0.99
R0826:Arhgef40 UTSW 14 52,238,450 (GRCm39) missense probably benign 0.05
R1126:Arhgef40 UTSW 14 52,234,583 (GRCm39) missense probably damaging 0.96
R1330:Arhgef40 UTSW 14 52,227,613 (GRCm39) missense probably benign 0.42
R1794:Arhgef40 UTSW 14 52,227,387 (GRCm39) missense possibly damaging 0.94
R1844:Arhgef40 UTSW 14 52,235,080 (GRCm39) missense probably damaging 0.99
R2018:Arhgef40 UTSW 14 52,241,162 (GRCm39) missense probably damaging 1.00
R2064:Arhgef40 UTSW 14 52,233,640 (GRCm39) missense probably damaging 1.00
R2321:Arhgef40 UTSW 14 52,231,733 (GRCm39) splice site probably benign
R3877:Arhgef40 UTSW 14 52,239,742 (GRCm39) missense probably damaging 1.00
R4233:Arhgef40 UTSW 14 52,227,628 (GRCm39) missense possibly damaging 0.50
R4596:Arhgef40 UTSW 14 52,224,681 (GRCm39) critical splice donor site probably null
R4676:Arhgef40 UTSW 14 52,228,416 (GRCm39) nonsense probably null
R4703:Arhgef40 UTSW 14 52,239,767 (GRCm39) missense probably damaging 1.00
R4704:Arhgef40 UTSW 14 52,239,767 (GRCm39) missense probably damaging 1.00
R4719:Arhgef40 UTSW 14 52,242,395 (GRCm39) unclassified probably benign
R4915:Arhgef40 UTSW 14 52,227,556 (GRCm39) missense probably damaging 1.00
R4917:Arhgef40 UTSW 14 52,227,556 (GRCm39) missense probably damaging 1.00
R4918:Arhgef40 UTSW 14 52,227,556 (GRCm39) missense probably damaging 1.00
R5097:Arhgef40 UTSW 14 52,227,146 (GRCm39) missense probably damaging 1.00
R5183:Arhgef40 UTSW 14 52,241,556 (GRCm39) missense probably damaging 0.98
R5195:Arhgef40 UTSW 14 52,227,269 (GRCm39) missense possibly damaging 0.68
R5367:Arhgef40 UTSW 14 52,227,156 (GRCm39) missense probably damaging 0.99
R5381:Arhgef40 UTSW 14 52,229,306 (GRCm39) missense probably damaging 0.99
R5594:Arhgef40 UTSW 14 52,233,614 (GRCm39) missense probably damaging 1.00
R5632:Arhgef40 UTSW 14 52,231,795 (GRCm39) missense probably damaging 1.00
R5665:Arhgef40 UTSW 14 52,238,357 (GRCm39) missense possibly damaging 0.80
R5798:Arhgef40 UTSW 14 52,234,489 (GRCm39) missense probably damaging 1.00
R5820:Arhgef40 UTSW 14 52,224,953 (GRCm39) missense possibly damaging 0.76
R6229:Arhgef40 UTSW 14 52,227,547 (GRCm39) missense probably benign 0.06
R6451:Arhgef40 UTSW 14 52,238,456 (GRCm39) missense probably damaging 1.00
R6633:Arhgef40 UTSW 14 52,234,888 (GRCm39) missense probably damaging 1.00
R6642:Arhgef40 UTSW 14 52,228,419 (GRCm39) unclassified probably benign
R6675:Arhgef40 UTSW 14 52,229,098 (GRCm39) missense probably damaging 0.99
R6781:Arhgef40 UTSW 14 52,235,354 (GRCm39) intron probably benign
R6901:Arhgef40 UTSW 14 52,234,825 (GRCm39) missense probably damaging 1.00
R7852:Arhgef40 UTSW 14 52,229,254 (GRCm39) missense unknown
R7857:Arhgef40 UTSW 14 52,226,212 (GRCm39) missense probably damaging 0.97
R7914:Arhgef40 UTSW 14 52,225,032 (GRCm39) missense probably damaging 1.00
R8060:Arhgef40 UTSW 14 52,222,452 (GRCm39) splice site probably benign
R8144:Arhgef40 UTSW 14 52,235,632 (GRCm39) missense probably damaging 1.00
R8195:Arhgef40 UTSW 14 52,226,226 (GRCm39) missense probably damaging 1.00
R8432:Arhgef40 UTSW 14 52,226,857 (GRCm39) missense probably benign 0.00
R8738:Arhgef40 UTSW 14 52,238,414 (GRCm39) missense probably damaging 1.00
R8830:Arhgef40 UTSW 14 52,241,165 (GRCm39) missense probably damaging 1.00
R9038:Arhgef40 UTSW 14 52,235,072 (GRCm39) missense probably damaging 0.96
R9712:Arhgef40 UTSW 14 52,226,415 (GRCm39) missense probably damaging 0.99
U24488:Arhgef40 UTSW 14 52,235,673 (GRCm39) missense probably benign 0.07
X0023:Arhgef40 UTSW 14 52,241,141 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAATCGGCATCTCTTCCCAAAACG -3'
(R):5'- GCTGTAAGCATCTCCCTAGCAACC -3'

Sequencing Primer
(F):5'- GAAGCCCTCTGTGAGCTG -3'
(R):5'- ACCAGATGGAAGGCTCTTTTAGC -3'
Posted On 2014-04-24