Mutagenetix > Incidental Mutations

Incidental Mutation 'R1612:Fbn2'

176901

Institutional Source

Beutler Lab

Gene Symbol

Fbn2

Ensembl Gene

ENSMUSG00000024598

Gene Name

fibrillin 2

Synonyms

Fib-2, sy, Sne

MMRRC Submission

039649-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.903) question?

Stock #

R1612 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58008623-58209926 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 58061752 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 1446 (C1446S)

Ref Sequence

ENSEMBL: ENSMUSP00000025497 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025497]

Predicted Effect

probably damaging
Transcript: ENSMUST00000025497
AA Change: C1446S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025497
Gene: ENSMUSG00000024598
AA Change: C1446S

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
low complexity region	29	52	N/A	INTRINSIC
low complexity region	68	77	N/A	INTRINSIC
EGF	148	176	1.15e1	SMART
EGF	179	208	1.26e-2	SMART
Pfam:TB	224	262	3.7e-10	PFAM
EGF_CA	276	317	8.3e-12	SMART
EGF_CA	318	359	9.25e-10	SMART
Pfam:TB	374	416	4.3e-13	PFAM
low complexity region	435	450	N/A	INTRINSIC
low complexity region	463	475	N/A	INTRINSIC
EGF	490	527	1.13e-4	SMART
EGF_CA	528	567	2.26e-13	SMART
EGF_CA	568	609	9.03e-13	SMART
EGF_CA	610	650	6.2e-11	SMART
EGF_CA	651	691	7.75e-12	SMART
Pfam:TB	707	748	5.2e-15	PFAM
EGF_CA	761	802	6.29e-12	SMART
EGF_CA	803	844	1.97e-13	SMART
EGF_CA	845	884	1.61e-9	SMART
Pfam:TB	899	935	1.8e-9	PFAM
EGF_CA	948	989	4.7e-11	SMART
Pfam:TB	1004	1044	1.3e-16	PFAM
EGF_CA	1066	1107	3.05e-10	SMART
EGF_CA	1108	1150	2.19e-11	SMART
EGF_CA	1151	1192	2.04e-11	SMART
EGF_CA	1193	1234	3.15e-12	SMART
EGF_CA	1235	1275	1.82e-8	SMART
EGF_CA	1276	1317	9.91e-10	SMART
EGF_CA	1318	1359	1.48e-8	SMART
EGF_CA	1360	1400	6.54e-10	SMART
EGF_CA	1401	1441	4.63e-10	SMART
EGF_CA	1442	1483	7.75e-12	SMART
EGF_CA	1484	1524	5.23e-9	SMART
EGF_CA	1525	1565	2.13e-9	SMART
Pfam:TB	1585	1625	3.4e-15	PFAM
EGF_CA	1643	1684	6.74e-12	SMART
EGF_CA	1685	1726	1.06e-9	SMART
Pfam:TB	1741	1783	1.2e-17	PFAM
EGF_CA	1801	1842	7.34e-13	SMART
EGF_CA	1843	1884	4.15e-12	SMART
EGF_CA	1885	1926	5.23e-9	SMART
EGF_CA	1927	1965	5.87e-12	SMART
EGF_CA	1966	2008	1.11e-12	SMART
EGF_CA	2009	2048	1.26e-11	SMART
EGF_CA	2049	2090	7.12e-11	SMART
Pfam:TB	2105	2147	1.2e-15	PFAM
EGF_CA	2164	2205	2.89e-11	SMART
EGF_CA	2206	2245	1.1e-11	SMART
EGF_CA	2246	2286	3.76e-10	SMART
EGF_CA	2287	2330	1.44e-6	SMART
EGF_CA	2331	2372	1.16e-10	SMART
Pfam:TB	2387	2429	1.9e-16	PFAM
EGF_CA	2442	2483	8.43e-13	SMART
EGF_CA	2484	2524	4.96e-10	SMART
EGF_CA	2525	2563	7.63e-11	SMART
EGF_CA	2564	2606	6.44e-9	SMART
EGF_CA	2607	2646	2.28e-9	SMART
EGF_CA	2647	2687	1.79e-7	SMART
EGF_CA	2688	2727	3.45e-9	SMART
low complexity region	2774	2786	N/A	INTRINSIC

Meta Mutation Damage Score

0.9700

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

97% (69/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of connective tissue microfibrils and may be involved in elastic fiber assembly. Mutations in this gene cause congenital contractural arachnodactyly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous, chemically-induced, and targeted null mutations show bilateral syndactyly with fusion of both soft and hard tissues. Deafness found in an X-ray induced allelic mutant is apparently due to the joint disruption of a linked gene. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579G24Rik	A	G	3: 79,631,144	T66A	probably benign	Het
9930021J03Rik	A	G	19: 29,717,845	V1483A	possibly damaging	Het
Actb	A	G	5: 142,905,595	F31S	probably damaging	Het
Adamts7	T	C	9: 90,188,697	S624P	possibly damaging	Het
Adh7	T	C	3: 138,228,881	I355T	possibly damaging	Het
Arhgef40	A	G	14: 52,004,081	E106G	probably damaging	Het
Cabp7	T	C	11: 4,739,198	D149G	probably damaging	Het
Cass4	A	T	2: 172,427,078	Q362L	possibly damaging	Het
Cd14	G	A	18: 36,725,665	Q246*	probably null	Het
Cdr2l	A	C	11: 115,393,406	E189D	probably benign	Het
Col6a6	A	G	9: 105,777,549	V991A	probably damaging	Het
Coq7	A	G	7: 118,509,911	W305R	unknown	Het
Cracr2a	G	T	6: 127,603,929	G23*	probably null	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Epcam	T	C	17: 87,639,938	L40P	possibly damaging	Het
Eps8	G	A	6: 137,500,618	P531S	probably benign	Het
Faap100	C	A	11: 120,377,088	L286F	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fmo3	A	G	1: 162,967,885	V127A	probably damaging	Het
Frem3	A	G	8: 80,614,861	D1261G	probably damaging	Het
Gabbr1	A	G	17: 37,070,669	Y775C	probably damaging	Het
Gbp11	G	T	5: 105,326,596	Q405K	possibly damaging	Het
Gdi2	T	A	13: 3,560,051	V260E	probably benign	Het
Glp2r	C	T	11: 67,742,207	V98M	possibly damaging	Het
Gm13741	T	C	2: 87,656,087	Y278C	probably damaging	Het
Gm7732	G	A	17: 21,129,915		noncoding transcript	Het
Gnptab	T	A	10: 88,428,482		probably null	Het
Hbs1l	T	G	10: 21,358,835	F596V	probably damaging	Het
Krt78	A	T	15: 101,951,844		probably null	Het
Krt83	A	T	15: 101,488,211	L223Q	probably benign	Het
Lcmt2	T	C	2: 121,139,120	Y274C	probably damaging	Het
Limd1	A	G	9: 123,518,154	Y620C	probably damaging	Het
Lvrn	G	T	18: 46,894,703	A862S	probably damaging	Het
Map4k2	A	G	19: 6,343,341	E206G	probably damaging	Het
Med16	A	G	10: 79,899,245	S461P	probably damaging	Het
Mrfap1	C	A	5: 36,796,362	A78S	probably damaging	Het
Mum1	T	A	10: 80,233,055		probably benign	Het
Nav2	T	A	7: 49,571,211	N1715K	probably damaging	Het
Ndc1	A	G	4: 107,395,068		probably benign	Het
Ngly1	G	T	14: 16,290,867	G450*	probably null	Het
Olfr195	T	C	16: 59,149,624	M258T	probably benign	Het
Olfr272	T	A	4: 52,911,501	M98L	probably benign	Het
Pde3b	T	A	7: 114,519,556	Y643*	probably null	Het
Pdilt	T	G	7: 119,486,975	N506H	possibly damaging	Het
Pear1	C	T	3: 87,751,853		probably null	Het
Pfkp	A	T	13: 6,588,589	M582K	probably damaging	Het
Pigl	T	A	11: 62,512,994	F251I	probably benign	Het
Plk3	A	G	4: 117,131,807	Y252H	probably damaging	Het
Prdx3	A	G	19: 60,874,434	S12P	possibly damaging	Het
Prkag2	T	C	5: 24,877,028	I96V	probably benign	Het
Rgs3	G	A	4: 62,625,935	V146M	probably damaging	Het
Serpinh1	T	C	7: 99,348,931	D164G	probably damaging	Het
Slc35d2	T	C	13: 64,111,510		probably benign	Het
Slc6a6	A	G	6: 91,741,027	N316D	probably damaging	Het
Snx14	A	T	9: 88,376,905	M973K	possibly damaging	Het
Sptan1	C	G	2: 30,003,336	R1126G	probably damaging	Het
Stpg3	T	C	2: 25,213,854	T157A	probably benign	Het
Tmem39b	A	T	4: 129,686,922	M259K	possibly damaging	Het
Tomm40l	A	T	1: 171,221,902		probably null	Het
Tsen34	G	T	7: 3,695,396	G180W	probably damaging	Het
Ube2l6	C	T	2: 84,806,373	R54W	probably damaging	Het
Vdac1	A	T	11: 52,384,070	T182S	probably benign	Het
Wdr3	T	C	3: 100,151,199		probably benign	Het
Wsb1	T	A	11: 79,248,585	Q95L	probably benign	Het

Other mutations in Fbn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00694:Fbn2	APN	18	58037809	missense	possibly damaging	0.81
IGL00780:Fbn2	APN	18	58095988	missense	probably damaging	1.00
IGL00923:Fbn2	APN	18	58012325	missense	probably benign	0.00
IGL01011:Fbn2	APN	18	58095240	splice site	probably benign
IGL01123:Fbn2	APN	18	58104081	missense	possibly damaging	0.62
IGL01304:Fbn2	APN	18	58061745	missense	probably damaging	0.97
IGL01339:Fbn2	APN	18	58113370	missense	possibly damaging	0.75
IGL01465:Fbn2	APN	18	58203833	missense	probably null	0.67
IGL01608:Fbn2	APN	18	58053704	nonsense	probably null
IGL01682:Fbn2	APN	18	58072671	missense	probably damaging	1.00
IGL01752:Fbn2	APN	18	58075977	splice site	probably null
IGL01764:Fbn2	APN	18	58045351	missense	probably damaging	1.00
IGL02002:Fbn2	APN	18	58114553	missense	probably benign	0.01
IGL02010:Fbn2	APN	18	58037722	missense	probably damaging	0.99
IGL02029:Fbn2	APN	18	58209603	missense	probably benign	0.04
IGL02037:Fbn2	APN	18	58096015	missense	probably damaging	1.00
IGL02350:Fbn2	APN	18	58103995	missense	possibly damaging	0.71
IGL02357:Fbn2	APN	18	58103995	missense	possibly damaging	0.71
IGL02653:Fbn2	APN	18	58076705	missense	probably benign
IGL03233:Fbn2	APN	18	58102377	missense	probably benign	0.39
IGL03347:Fbn2	APN	18	58013665	missense	probably damaging	1.00
IGL03410:Fbn2	APN	18	58050243	missense	possibly damaging	0.95
pinch	UTSW	18	58069184	missense	probably damaging	1.00
stick	UTSW	18	58071819	missense	possibly damaging	0.94
tweak	UTSW	18	58058389	missense	probably damaging	1.00
BB009:Fbn2	UTSW	18	58020483	missense	possibly damaging	0.61
BB019:Fbn2	UTSW	18	58020483	missense	possibly damaging	0.61
PIT4434001:Fbn2	UTSW	18	58096062	missense	probably damaging	0.99
R0020:Fbn2	UTSW	18	58105164	missense	probably damaging	1.00
R0069:Fbn2	UTSW	18	58069184	missense	probably damaging	1.00
R0107:Fbn2	UTSW	18	58056203	missense	probably benign	0.00
R0116:Fbn2	UTSW	18	58102373	nonsense	probably null
R0277:Fbn2	UTSW	18	58045317	missense	probably damaging	1.00
R0284:Fbn2	UTSW	18	58050290	splice site	probably benign
R0316:Fbn2	UTSW	18	58113325	missense	probably damaging	1.00
R0323:Fbn2	UTSW	18	58045317	missense	probably damaging	1.00
R0421:Fbn2	UTSW	18	58027804	splice site	probably benign
R0455:Fbn2	UTSW	18	58035336	missense	probably damaging	1.00
R0504:Fbn2	UTSW	18	58039460	missense	possibly damaging	0.94
R0520:Fbn2	UTSW	18	58013749	missense	probably damaging	1.00
R0632:Fbn2	UTSW	18	58037747	missense	probably damaging	1.00
R0638:Fbn2	UTSW	18	58045374	missense	probably damaging	0.98
R0645:Fbn2	UTSW	18	58058389	missense	probably damaging	1.00
R1051:Fbn2	UTSW	18	58012353	missense	probably damaging	0.99
R1209:Fbn2	UTSW	18	58070016	missense	probably benign	0.00
R1319:Fbn2	UTSW	18	58200610	missense	possibly damaging	0.88
R1400:Fbn2	UTSW	18	58080193	missense	possibly damaging	0.90
R1437:Fbn2	UTSW	18	58053659	missense	possibly damaging	0.68
R1463:Fbn2	UTSW	18	58010380	missense	probably benign
R1623:Fbn2	UTSW	18	58048548	missense	possibly damaging	0.61
R1629:Fbn2	UTSW	18	58026538	missense	probably damaging	1.00
R1639:Fbn2	UTSW	18	58058462	missense	probably benign	0.41
R1722:Fbn2	UTSW	18	58048052	critical splice acceptor site	probably null
R1749:Fbn2	UTSW	18	58050276	missense	probably benign	0.35
R1802:Fbn2	UTSW	18	58052976	nonsense	probably null
R1850:Fbn2	UTSW	18	58039305	splice site	probably benign
R1913:Fbn2	UTSW	18	58061742	missense	probably damaging	1.00
R2045:Fbn2	UTSW	18	58090658	missense	probably damaging	1.00
R2064:Fbn2	UTSW	18	58048849	missense	probably damaging	0.99
R2143:Fbn2	UTSW	18	58052993	missense	possibly damaging	0.65
R2144:Fbn2	UTSW	18	58052993	missense	possibly damaging	0.65
R2149:Fbn2	UTSW	18	58102325	splice site	probably null
R2207:Fbn2	UTSW	18	58081399	nonsense	probably null
R2219:Fbn2	UTSW	18	58052963	missense	possibly damaging	0.79
R2263:Fbn2	UTSW	18	58095176	splice site	probably benign
R2375:Fbn2	UTSW	18	58035966	missense	probably damaging	1.00
R2424:Fbn2	UTSW	18	58203787	missense	probably damaging	0.99
R2504:Fbn2	UTSW	18	58093359	missense	probably damaging	0.99
R2879:Fbn2	UTSW	18	58069242	missense	probably damaging	0.97
R3040:Fbn2	UTSW	18	58093387	missense	probably damaging	1.00
R3080:Fbn2	UTSW	18	58149050	missense	probably damaging	0.97
R3625:Fbn2	UTSW	18	58061742	missense	probably damaging	1.00
R3901:Fbn2	UTSW	18	58066011	missense	probably damaging	0.97
R4089:Fbn2	UTSW	18	58053769	missense	probably benign	0.01
R4133:Fbn2	UTSW	18	58095962	missense	possibly damaging	0.82
R4155:Fbn2	UTSW	18	58023287	nonsense	probably null
R4288:Fbn2	UTSW	18	58035339	missense	probably damaging	0.98
R4289:Fbn2	UTSW	18	58035339	missense	probably damaging	0.98
R4363:Fbn2	UTSW	18	58149050	missense	probably damaging	0.97
R4559:Fbn2	UTSW	18	58076074	missense	probably benign	0.00
R4601:Fbn2	UTSW	18	58053733	missense	probably damaging	1.00
R4609:Fbn2	UTSW	18	58190269	nonsense	probably null
R4626:Fbn2	UTSW	18	58013747	nonsense	probably null
R4638:Fbn2	UTSW	18	58010304	missense	probably benign	0.01
R4675:Fbn2	UTSW	18	58040193	missense	possibly damaging	0.95
R4707:Fbn2	UTSW	18	58056272	missense	probably damaging	1.00
R4758:Fbn2	UTSW	18	58026386	missense	probably benign	0.00
R4945:Fbn2	UTSW	18	58050253	missense	possibly damaging	0.53
R4955:Fbn2	UTSW	18	58058383	missense	possibly damaging	0.61
R4980:Fbn2	UTSW	18	58010631	missense	probably benign	0.05
R4998:Fbn2	UTSW	18	58072631	missense	probably damaging	1.00
R5133:Fbn2	UTSW	18	58039340	missense	probably damaging	0.99
R5322:Fbn2	UTSW	18	58039315	missense	probably benign	0.00
R5414:Fbn2	UTSW	18	58093405	missense	probably damaging	0.96
R5538:Fbn2	UTSW	18	58071901	missense	probably benign	0.22
R5557:Fbn2	UTSW	18	58115659	missense	probably benign	0.00
R5754:Fbn2	UTSW	18	58124311	missense	probably benign	0.04
R5769:Fbn2	UTSW	18	58105199	missense	probably damaging	1.00
R5790:Fbn2	UTSW	18	58076696	missense	probably benign	0.34
R5830:Fbn2	UTSW	18	58114469	missense	probably benign	0.01
R5845:Fbn2	UTSW	18	58053768	missense	possibly damaging	0.89
R5880:Fbn2	UTSW	18	58023282	nonsense	probably null
R5907:Fbn2	UTSW	18	58045337	missense	probably damaging	1.00
R5948:Fbn2	UTSW	18	58037049	missense	probably damaging	1.00
R5955:Fbn2	UTSW	18	58044256	missense	probably damaging	1.00
R5974:Fbn2	UTSW	18	58048920	missense	probably damaging	1.00
R6010:Fbn2	UTSW	18	58069524	missense	probably benign	0.31
R6024:Fbn2	UTSW	18	58076836	missense	probably benign	0.03
R6037:Fbn2	UTSW	18	58044223	missense	probably benign	0.05
R6037:Fbn2	UTSW	18	58044223	missense	probably benign	0.05
R6315:Fbn2	UTSW	18	58054953	critical splice acceptor site	probably null
R6437:Fbn2	UTSW	18	58113363	missense	probably damaging	1.00
R6519:Fbn2	UTSW	18	58063575	missense	possibly damaging	0.61
R6520:Fbn2	UTSW	18	58102390	missense	probably damaging	1.00
R6734:Fbn2	UTSW	18	58035960	missense	probably damaging	1.00
R6755:Fbn2	UTSW	18	58113333	missense	possibly damaging	0.89
R6789:Fbn2	UTSW	18	58010614	missense	probably benign	0.00
R6801:Fbn2	UTSW	18	58113348	missense	probably benign	0.04
R6862:Fbn2	UTSW	18	58124321	missense	probably benign	0.04
R6900:Fbn2	UTSW	18	58076831	missense	probably benign
R6906:Fbn2	UTSW	18	58071819	missense	possibly damaging	0.94
R6919:Fbn2	UTSW	18	58124187	splice site	probably null
R6950:Fbn2	UTSW	18	58035921	missense	probably null	0.21
R6985:Fbn2	UTSW	18	58068388	missense	probably damaging	1.00
R7056:Fbn2	UTSW	18	58076726	missense	probably benign
R7199:Fbn2	UTSW	18	58053761	nonsense	probably null
R7219:Fbn2	UTSW	18	58053027	missense	probably benign	0.04
R7226:Fbn2	UTSW	18	58037070	missense	probably damaging	1.00
R7260:Fbn2	UTSW	18	58066116	missense	probably benign	0.14
R7414:Fbn2	UTSW	18	58096050	missense	probably damaging	1.00
R7485:Fbn2	UTSW	18	58071840	missense	possibly damaging	0.50
R7523:Fbn2	UTSW	18	58066080	missense	probably benign	0.01
R7549:Fbn2	UTSW	18	58020464	nonsense	probably null
R7619:Fbn2	UTSW	18	58080227	missense	possibly damaging	0.46
R7638:Fbn2	UTSW	18	58105136	missense	probably damaging	1.00
R7789:Fbn2	UTSW	18	58039313	missense	probably benign	0.22
R7932:Fbn2	UTSW	18	58020483	missense	possibly damaging	0.61
R8013:Fbn2	UTSW	18	58104081	missense	possibly damaging	0.62
R8076:Fbn2	UTSW	18	58026424	nonsense	probably null
R8300:Fbn2	UTSW	18	58209615	missense	probably benign
R8345:Fbn2	UTSW	18	58058431	missense	probably damaging	1.00
R8487:Fbn2	UTSW	18	58020390	missense	possibly damaging	0.53
R8520:Fbn2	UTSW	18	58038198	critical splice donor site	probably null
X0062:Fbn2	UTSW	18	58056213	missense	probably damaging	1.00
Z1177:Fbn2	UTSW	18	58010379	missense	probably benign	0.00
Z1177:Fbn2	UTSW	18	58055482	missense	probably benign	0.00
Z1177:Fbn2	UTSW	18	58069190	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGTGCAACATGTGCCGTGCAG -3'
(R):5'- TGGATCTCTGATCTCAGGCCACAC -3'

Sequencing Primer
(F):5'- CGTGCAGTCTGCTTCCAG -3'
(R):5'- CACATCCCAAATCTAGTGAATGG -3'

Posted On

2014-04-24