Incidental Mutation 'R1613:Col6a6'
ID176945
Institutional Source Beutler Lab
Gene Symbol Col6a6
Ensembl Gene ENSMUSG00000043719
Gene Namecollagen, type VI, alpha 6
SynonymsE330026B02Rik
MMRRC Submission 039650-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R1613 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location105687809-105828160 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 105732211 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098441] [ENSMUST00000166431]
Predicted Effect probably null
Transcript: ENSMUST00000098441
SMART Domains Protein: ENSMUSP00000096040
Gene: ENSMUSG00000043719

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 3.3e-9 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166431
SMART Domains Protein: ENSMUSP00000125765
Gene: ENSMUSG00000043719

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 9.3e-10 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195709
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency 82% (69/84)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrp G T 8: 105,566,835 T106K probably damaging Het
Aldh3a1 A T 11: 61,214,551 D161V probably damaging Het
Aloxe3 A G 11: 69,130,046 D199G possibly damaging Het
Amfr T A 8: 93,999,226 M176L probably benign Het
Amigo1 A T 3: 108,188,220 E345V probably benign Het
Atp13a3 T C 16: 30,332,300 Y1064C probably damaging Het
AU019823 T C 9: 50,607,805 K169R probably damaging Het
Brd7 A T 8: 88,346,950 C271S probably benign Het
Bub1b T A 2: 118,639,741 probably null Het
Ccdc146 T A 5: 21,294,524 I887F probably damaging Het
Ceacam14 T C 7: 17,814,048 probably benign Het
Cntn1 T A 15: 92,245,990 V278E possibly damaging Het
Cspp1 C T 1: 10,133,241 R1016C probably damaging Het
Cyp2c39 A G 19: 39,539,011 Y267C probably damaging Het
Cyp2c67 C T 19: 39,626,199 V295I probably benign Het
Cyp2d40 T C 15: 82,761,439 T122A unknown Het
Dmxl2 A G 9: 54,382,027 I2541T probably benign Het
Eif3e G A 15: 43,250,224 A438V possibly damaging Het
Fam178b C A 1: 36,600,192 W342L probably benign Het
Fam45a T A 19: 60,822,325 V171D possibly damaging Het
Fam78a G T 2: 32,069,569 N176K probably damaging Het
Ghrhr A T 6: 55,379,697 K93M probably damaging Het
Gm1527 T A 3: 28,898,853 probably null Het
Gm1553 G A 10: 82,492,596 probably benign Het
Gm5885 G A 6: 133,531,242 noncoding transcript Het
Gm8674 G A 13: 49,902,438 noncoding transcript Het
Hoxc6 C T 15: 103,009,585 probably benign Het
Ino80 T C 2: 119,392,867 T1189A probably damaging Het
Iqgap1 T C 7: 80,768,457 E55G probably damaging Het
Kcnh2 G A 5: 24,322,762 probably benign Het
Lama1 G A 17: 67,807,923 G2356S probably benign Het
Mdfic T A 6: 15,799,590 probably null Het
Me3 T C 7: 89,786,420 probably benign Het
Mmadhc T C 2: 50,280,326 D258G probably damaging Het
Nfe2 T C 15: 103,249,129 D145G probably damaging Het
Olfr1039 A T 2: 86,131,063 L200Q probably damaging Het
Olfr1200 T C 2: 88,767,805 N170S probably damaging Het
Olfr1377 T A 11: 50,985,218 N172K probably damaging Het
Olfr1391 A G 11: 49,327,693 Y94C probably damaging Het
Olfr1404 C T 1: 173,215,867 T72I probably benign Het
Olfr352 A C 2: 36,870,393 I276L possibly damaging Het
Olfr728 A C 14: 50,140,294 L115R probably damaging Het
P4ha3 A T 7: 100,313,250 D405V possibly damaging Het
Palmd T C 3: 116,923,504 D448G probably damaging Het
Pclo T C 5: 14,679,132 probably benign Het
Pcsk6 A G 7: 65,910,311 probably benign Het
Pidd1 T C 7: 141,440,777 E469G probably damaging Het
Ptpn13 A G 5: 103,536,871 D875G possibly damaging Het
Rasgrf2 A G 13: 91,902,621 L886P probably damaging Het
Scrib G A 15: 76,048,542 R1454C probably damaging Het
Slc24a1 A G 9: 64,948,696 S310P unknown Het
Slc44a5 A G 3: 154,257,714 probably null Het
Snx4 T G 16: 33,286,046 M283R probably damaging Het
Snx7 A T 3: 117,829,573 probably benign Het
Stk19 A T 17: 34,824,598 L212H probably damaging Het
Sult2a4 T C 7: 13,989,495 K32E probably damaging Het
Tfrc T A 16: 32,623,375 Y473N probably damaging Het
Tlr2 C G 3: 83,837,353 L474F probably damaging Het
Tnfrsf4 T A 4: 156,016,162 F213I probably benign Het
Trim9 A T 12: 70,248,395 I651N probably damaging Het
Vmn1r84 T A 7: 12,362,533 I78L possibly damaging Het
Vmn2r77 T C 7: 86,811,148 Y561H probably damaging Het
Vmn2r95 A G 17: 18,440,639 probably benign Het
Zfp11 T C 5: 129,658,367 N10S probably benign Het
Zfp81 A T 17: 33,334,783 H352Q probably damaging Het
Zscan5b T A 7: 6,230,375 L66Q probably damaging Het
Other mutations in Col6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Col6a6 APN 9 105758191 critical splice acceptor site probably null
IGL00768:Col6a6 APN 9 105782412 missense probably benign 0.04
IGL00917:Col6a6 APN 9 105784254 splice site probably benign
IGL01385:Col6a6 APN 9 105783666 missense probably damaging 1.00
IGL01411:Col6a6 APN 9 105785958 nonsense probably null
IGL01508:Col6a6 APN 9 105727166 splice site probably benign
IGL01668:Col6a6 APN 9 105709271 missense probably damaging 1.00
IGL01733:Col6a6 APN 9 105709255 missense possibly damaging 0.92
IGL01932:Col6a6 APN 9 105689626 missense probably benign 0.02
IGL01934:Col6a6 APN 9 105698659 critical splice donor site probably null
IGL01944:Col6a6 APN 9 105783909 missense probably damaging 1.00
IGL01980:Col6a6 APN 9 105780985 missense probably damaging 0.96
IGL02114:Col6a6 APN 9 105767199 critical splice donor site probably null
IGL02129:Col6a6 APN 9 105736340 splice site probably benign
IGL02201:Col6a6 APN 9 105780995 missense probably damaging 1.00
IGL02335:Col6a6 APN 9 105784101 missense probably damaging 1.00
IGL02541:Col6a6 APN 9 105732216 missense probably benign 0.05
IGL02574:Col6a6 APN 9 105782191 missense probably damaging 1.00
IGL02649:Col6a6 APN 9 105727170 critical splice donor site probably null
IGL02852:Col6a6 APN 9 105784073 missense probably damaging 0.99
IGL03278:Col6a6 APN 9 105709452 missense probably benign 0.01
IGL03327:Col6a6 APN 9 105767234 missense possibly damaging 0.90
PIT4519001:Col6a6 UTSW 9 105732263 missense probably benign 0.23
R0042:Col6a6 UTSW 9 105780697 missense possibly damaging 0.89
R0046:Col6a6 UTSW 9 105748848 splice site probably benign
R0066:Col6a6 UTSW 9 105702213 missense probably damaging 0.99
R0066:Col6a6 UTSW 9 105702213 missense probably damaging 0.99
R0140:Col6a6 UTSW 9 105702275 missense probably damaging 1.00
R0278:Col6a6 UTSW 9 105767288 missense possibly damaging 0.87
R0281:Col6a6 UTSW 9 105784116 missense probably benign 0.13
R0382:Col6a6 UTSW 9 105755555 missense probably damaging 0.98
R0389:Col6a6 UTSW 9 105784204 missense probably benign 0.02
R0421:Col6a6 UTSW 9 105784206 missense probably benign 0.02
R0502:Col6a6 UTSW 9 105767351 missense probably benign 0.04
R0503:Col6a6 UTSW 9 105767351 missense probably benign 0.04
R0600:Col6a6 UTSW 9 105761440 missense probably damaging 1.00
R0626:Col6a6 UTSW 9 105777744 missense probably benign 0.45
R0629:Col6a6 UTSW 9 105727165 splice site probably benign
R0690:Col6a6 UTSW 9 105709486 missense probably benign 0.01
R1155:Col6a6 UTSW 9 105782090 missense possibly damaging 0.64
R1245:Col6a6 UTSW 9 105748910 missense possibly damaging 0.62
R1253:Col6a6 UTSW 9 105774303 missense probably null 0.98
R1263:Col6a6 UTSW 9 105709489 missense probably benign 0.01
R1296:Col6a6 UTSW 9 105781091 missense probably damaging 1.00
R1556:Col6a6 UTSW 9 105709473 missense possibly damaging 0.82
R1600:Col6a6 UTSW 9 105778075 missense probably damaging 1.00
R1612:Col6a6 UTSW 9 105777549 missense probably damaging 1.00
R1830:Col6a6 UTSW 9 105702270 missense probably damaging 0.99
R1858:Col6a6 UTSW 9 105781102 missense probably damaging 1.00
R1897:Col6a6 UTSW 9 105785744 missense possibly damaging 0.74
R1944:Col6a6 UTSW 9 105709384 missense probably damaging 1.00
R2366:Col6a6 UTSW 9 105755694 missense probably damaging 1.00
R2484:Col6a6 UTSW 9 105780804 missense probably damaging 0.98
R3079:Col6a6 UTSW 9 105754223 missense probably benign 0.01
R3176:Col6a6 UTSW 9 105786230 missense probably benign 0.01
R3276:Col6a6 UTSW 9 105786230 missense probably benign 0.01
R3429:Col6a6 UTSW 9 105777967 missense probably damaging 1.00
R3716:Col6a6 UTSW 9 105782174 missense probably damaging 0.98
R3809:Col6a6 UTSW 9 105780692 missense probably damaging 1.00
R3978:Col6a6 UTSW 9 105698879 missense probably damaging 0.98
R4087:Col6a6 UTSW 9 105783956 missense possibly damaging 0.68
R4382:Col6a6 UTSW 9 105783690 missense probably damaging 1.00
R4516:Col6a6 UTSW 9 105698949 missense possibly damaging 0.64
R4666:Col6a6 UTSW 9 105767342 missense possibly damaging 0.93
R4905:Col6a6 UTSW 9 105767424 missense probably damaging 1.00
R4923:Col6a6 UTSW 9 105788948 missense probably damaging 1.00
R4951:Col6a6 UTSW 9 105767198 critical splice donor site probably null
R5002:Col6a6 UTSW 9 105786093 missense probably benign 0.00
R5111:Col6a6 UTSW 9 105709474 missense possibly damaging 0.70
R5205:Col6a6 UTSW 9 105782033 missense probably damaging 0.99
R5399:Col6a6 UTSW 9 105709107 missense possibly damaging 0.50
R5475:Col6a6 UTSW 9 105774338 missense probably null 0.79
R5491:Col6a6 UTSW 9 105738236 missense probably damaging 0.98
R5758:Col6a6 UTSW 9 105761518 critical splice acceptor site probably null
R5934:Col6a6 UTSW 9 105767075 missense probably damaging 1.00
R6059:Col6a6 UTSW 9 105783917 missense probably damaging 1.00
R6284:Col6a6 UTSW 9 105727227 splice site probably null
R6425:Col6a6 UTSW 9 105698865 missense probably benign 0.21
R6464:Col6a6 UTSW 9 105788953 start codon destroyed probably null 0.60
R6469:Col6a6 UTSW 9 105698691 missense probably damaging 0.97
R6520:Col6a6 UTSW 9 105785825 missense possibly damaging 0.89
R6552:Col6a6 UTSW 9 105698913 missense probably damaging 1.00
R6750:Col6a6 UTSW 9 105783680 missense probably damaging 1.00
R6813:Col6a6 UTSW 9 105783941 missense probably benign 0.32
R7032:Col6a6 UTSW 9 105767508 missense probably damaging 0.96
R7260:Col6a6 UTSW 9 105783969 missense probably benign 0.00
R7472:Col6a6 UTSW 9 105782423 missense probably damaging 1.00
R7541:Col6a6 UTSW 9 105767324 missense probably damaging 1.00
R7640:Col6a6 UTSW 9 105785744 missense possibly damaging 0.74
R7645:Col6a6 UTSW 9 105767198 critical splice donor site probably null
R7716:Col6a6 UTSW 9 105783903 missense possibly damaging 0.84
X0022:Col6a6 UTSW 9 105699332 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATGCTGAGCTAGAGCCCCTGAC -3'
(R):5'- CGTTTGGACACGGAGACTCACAAAG -3'

Sequencing Primer
(F):5'- TAGAGCCCCTGACCTCATC -3'
(R):5'- GTAGGATCAGCTTAGCCTGTAACTC -3'
Posted On2014-04-24