Incidental Mutation 'R1613:Aloxe3'
ID176950
Institutional Source Beutler Lab
Gene Symbol Aloxe3
Ensembl Gene ENSMUSG00000020892
Gene Namearachidonate lipoxygenase 3
Synonymse-LOX-3
MMRRC Submission 039650-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1613 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69125896-69149115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69130046 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 199 (D199G)
Ref Sequence ENSEMBL: ENSMUSP00000134814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021268] [ENSMUST00000175661]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021268
AA Change: D199G

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021268
Gene: ENSMUSG00000020892
AA Change: D199G

DomainStartEndE-ValueType
LH2 2 116 1.93e-20 SMART
Pfam:Lipoxygenase 249 697 3.4e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156874
Predicted Effect possibly damaging
Transcript: ENSMUST00000175661
AA Change: D199G

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134814
Gene: ENSMUSG00000020892
AA Change: D199G

DomainStartEndE-ValueType
LH2 2 116 1.93e-20 SMART
Pfam:Lipoxygenase 245 377 7.6e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176087
Meta Mutation Damage Score 0.3390 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency 82% (69/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the lipoxygenase family, which are catabolized by arachidonic acid-derived compounds. The encoded enzyme is a hydroperoxide isomerase that synthesizes a unique type of epoxy alcohol (8R-hydroxy-11R,12R-epoxyeicosa-5Z,9E,14Z-trienoic acid) from 12R-hydroperoxyeicosatetraenoic acid (12R-HPETE). This epoxy alcohol can activate the the nuclear receptor peroxisome proliferator-activated receptor alpha (PPARalpha), which is implicated in epidermal differentiation. Loss of function of the enzyme encoded by this gene results in ichthyosis, implicating the function of this gene in the differentiation of human skin. This gene is part of a cluster of lipoxygenase genes on 17p13.1. Mutations in this gene result in nonbullous congenital ichthyosiform erythroderma (NCIE). Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete neonatal lethality, imapired skin barrier function, dehydration, tightly packed stratum corneum, impaired stratum corneum desquamation and reduced levels of ester-bound ceramide in the epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrp G T 8: 105,566,835 T106K probably damaging Het
Aldh3a1 A T 11: 61,214,551 D161V probably damaging Het
Amfr T A 8: 93,999,226 M176L probably benign Het
Amigo1 A T 3: 108,188,220 E345V probably benign Het
Atp13a3 T C 16: 30,332,300 Y1064C probably damaging Het
AU019823 T C 9: 50,607,805 K169R probably damaging Het
Brd7 A T 8: 88,346,950 C271S probably benign Het
Bub1b T A 2: 118,639,741 probably null Het
Ccdc146 T A 5: 21,294,524 I887F probably damaging Het
Ceacam14 T C 7: 17,814,048 probably benign Het
Cntn1 T A 15: 92,245,990 V278E possibly damaging Het
Col6a6 A C 9: 105,732,211 probably null Het
Cspp1 C T 1: 10,133,241 R1016C probably damaging Het
Cyp2c39 A G 19: 39,539,011 Y267C probably damaging Het
Cyp2c67 C T 19: 39,626,199 V295I probably benign Het
Cyp2d40 T C 15: 82,761,439 T122A unknown Het
Dmxl2 A G 9: 54,382,027 I2541T probably benign Het
Eif3e G A 15: 43,250,224 A438V possibly damaging Het
Fam178b C A 1: 36,600,192 W342L probably benign Het
Fam45a T A 19: 60,822,325 V171D possibly damaging Het
Fam78a G T 2: 32,069,569 N176K probably damaging Het
Ghrhr A T 6: 55,379,697 K93M probably damaging Het
Gm1527 T A 3: 28,898,853 probably null Het
Gm1553 G A 10: 82,492,596 probably benign Het
Gm5885 G A 6: 133,531,242 noncoding transcript Het
Gm8674 G A 13: 49,902,438 noncoding transcript Het
Hoxc6 C T 15: 103,009,585 probably benign Het
Ino80 T C 2: 119,392,867 T1189A probably damaging Het
Iqgap1 T C 7: 80,768,457 E55G probably damaging Het
Kcnh2 G A 5: 24,322,762 probably benign Het
Lama1 G A 17: 67,807,923 G2356S probably benign Het
Mdfic T A 6: 15,799,590 probably null Het
Me3 T C 7: 89,786,420 probably benign Het
Mmadhc T C 2: 50,280,326 D258G probably damaging Het
Nfe2 T C 15: 103,249,129 D145G probably damaging Het
Olfr1039 A T 2: 86,131,063 L200Q probably damaging Het
Olfr1200 T C 2: 88,767,805 N170S probably damaging Het
Olfr1377 T A 11: 50,985,218 N172K probably damaging Het
Olfr1391 A G 11: 49,327,693 Y94C probably damaging Het
Olfr1404 C T 1: 173,215,867 T72I probably benign Het
Olfr352 A C 2: 36,870,393 I276L possibly damaging Het
Olfr728 A C 14: 50,140,294 L115R probably damaging Het
P4ha3 A T 7: 100,313,250 D405V possibly damaging Het
Palmd T C 3: 116,923,504 D448G probably damaging Het
Pclo T C 5: 14,679,132 probably benign Het
Pcsk6 A G 7: 65,910,311 probably benign Het
Pidd1 T C 7: 141,440,777 E469G probably damaging Het
Ptpn13 A G 5: 103,536,871 D875G possibly damaging Het
Rasgrf2 A G 13: 91,902,621 L886P probably damaging Het
Scrib G A 15: 76,048,542 R1454C probably damaging Het
Slc24a1 A G 9: 64,948,696 S310P unknown Het
Slc44a5 A G 3: 154,257,714 probably null Het
Snx4 T G 16: 33,286,046 M283R probably damaging Het
Snx7 A T 3: 117,829,573 probably benign Het
Stk19 A T 17: 34,824,598 L212H probably damaging Het
Sult2a4 T C 7: 13,989,495 K32E probably damaging Het
Tfrc T A 16: 32,623,375 Y473N probably damaging Het
Tlr2 C G 3: 83,837,353 L474F probably damaging Het
Tnfrsf4 T A 4: 156,016,162 F213I probably benign Het
Trim9 A T 12: 70,248,395 I651N probably damaging Het
Vmn1r84 T A 7: 12,362,533 I78L possibly damaging Het
Vmn2r77 T C 7: 86,811,148 Y561H probably damaging Het
Vmn2r95 A G 17: 18,440,639 probably benign Het
Zfp11 T C 5: 129,658,367 N10S probably benign Het
Zfp81 A T 17: 33,334,783 H352Q probably damaging Het
Zscan5b T A 7: 6,230,375 L66Q probably damaging Het
Other mutations in Aloxe3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Aloxe3 APN 11 69130013 missense probably benign 0.41
IGL01925:Aloxe3 APN 11 69128633 missense probably damaging 1.00
IGL01947:Aloxe3 APN 11 69143021 splice site probably benign
IGL02421:Aloxe3 APN 11 69130046 missense possibly damaging 0.87
IGL03206:Aloxe3 APN 11 69129646 missense possibly damaging 0.74
IGL03054:Aloxe3 UTSW 11 69129607 missense possibly damaging 0.78
R1757:Aloxe3 UTSW 11 69135949 missense possibly damaging 0.72
R1839:Aloxe3 UTSW 11 69130085 missense probably damaging 1.00
R2182:Aloxe3 UTSW 11 69129600 missense possibly damaging 0.93
R2912:Aloxe3 UTSW 11 69130040 missense probably damaging 1.00
R2919:Aloxe3 UTSW 11 69142923 missense probably damaging 0.99
R2920:Aloxe3 UTSW 11 69142923 missense probably damaging 0.99
R4731:Aloxe3 UTSW 11 69128654 missense probably null 0.59
R5245:Aloxe3 UTSW 11 69129676 missense probably benign 0.00
R5459:Aloxe3 UTSW 11 69132828 missense possibly damaging 0.66
R5493:Aloxe3 UTSW 11 69128617 nonsense probably null
R5725:Aloxe3 UTSW 11 69128654 missense probably null 0.59
R5755:Aloxe3 UTSW 11 69132749 missense probably benign 0.04
R5789:Aloxe3 UTSW 11 69126439 missense probably damaging 1.00
R7343:Aloxe3 UTSW 11 69132743 missense probably benign 0.00
R7419:Aloxe3 UTSW 11 69127527 missense probably benign 0.00
R7451:Aloxe3 UTSW 11 69142920 missense possibly damaging 0.90
R7669:Aloxe3 UTSW 11 69135120 missense probably benign 0.00
X0019:Aloxe3 UTSW 11 69148735 missense probably damaging 1.00
X0020:Aloxe3 UTSW 11 69133027 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGAAAGTAGACCACCGTGTGTTGAG -3'
(R):5'- TGGAGTTGAACCTGAGATGGCCTG -3'

Sequencing Primer
(F):5'- GGTATCCGAGTCCATGTCAAG -3'
(R):5'- tgggaggaaggaaggaagg -3'
Posted On2014-04-24