Incidental Mutation 'R1613:Trim9'
ID176951
Institutional Source Beutler Lab
Gene Symbol Trim9
Ensembl Gene ENSMUSG00000021071
Gene Nametripartite motif-containing 9
Synonyms
MMRRC Submission 039650-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R1613 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location70244533-70347614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70248395 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 651 (I651N)
Ref Sequence ENSEMBL: ENSMUSP00000106149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110520] [ENSMUST00000110522] [ENSMUST00000222316] [ENSMUST00000223160]
Predicted Effect probably damaging
Transcript: ENSMUST00000110520
AA Change: I651N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106149
Gene: ENSMUSG00000021071
AA Change: I651N

DomainStartEndE-ValueType
RING 10 131 1.23e-4 SMART
BBOX 163 212 2.84e-9 SMART
BBOX 224 266 9.89e-9 SMART
BBC 273 399 1.29e-38 SMART
FN3 439 522 4.09e-7 SMART
Pfam:SPRY 598 702 2.4e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110522
AA Change: I725N

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106151
Gene: ENSMUSG00000021071
AA Change: I725N

DomainStartEndE-ValueType
RING 10 131 1.23e-4 SMART
BBOX 163 212 2.84e-9 SMART
BBOX 224 266 9.89e-9 SMART
BBC 273 399 1.29e-38 SMART
FN3 439 522 4.09e-7 SMART
low complexity region 591 605 N/A INTRINSIC
Pfam:SPRY 674 776 1.5e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000221294
AA Change: I697N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222173
Predicted Effect possibly damaging
Transcript: ENSMUST00000222316
AA Change: I743N

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223160
AA Change: I647N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223518
Meta Mutation Damage Score 0.9268 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency 82% (69/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. Its function has not been identified. Alternate splicing of this gene generates two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display increased axonal branching and increased corpus callosum thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrp G T 8: 105,566,835 T106K probably damaging Het
Aldh3a1 A T 11: 61,214,551 D161V probably damaging Het
Aloxe3 A G 11: 69,130,046 D199G possibly damaging Het
Amfr T A 8: 93,999,226 M176L probably benign Het
Amigo1 A T 3: 108,188,220 E345V probably benign Het
Atp13a3 T C 16: 30,332,300 Y1064C probably damaging Het
AU019823 T C 9: 50,607,805 K169R probably damaging Het
Brd7 A T 8: 88,346,950 C271S probably benign Het
Bub1b T A 2: 118,639,741 probably null Het
Ccdc146 T A 5: 21,294,524 I887F probably damaging Het
Ceacam14 T C 7: 17,814,048 probably benign Het
Cntn1 T A 15: 92,245,990 V278E possibly damaging Het
Col6a6 A C 9: 105,732,211 probably null Het
Cspp1 C T 1: 10,133,241 R1016C probably damaging Het
Cyp2c39 A G 19: 39,539,011 Y267C probably damaging Het
Cyp2c67 C T 19: 39,626,199 V295I probably benign Het
Cyp2d40 T C 15: 82,761,439 T122A unknown Het
Dmxl2 A G 9: 54,382,027 I2541T probably benign Het
Eif3e G A 15: 43,250,224 A438V possibly damaging Het
Fam178b C A 1: 36,600,192 W342L probably benign Het
Fam45a T A 19: 60,822,325 V171D possibly damaging Het
Fam78a G T 2: 32,069,569 N176K probably damaging Het
Ghrhr A T 6: 55,379,697 K93M probably damaging Het
Gm1527 T A 3: 28,898,853 probably null Het
Gm1553 G A 10: 82,492,596 probably benign Het
Gm5885 G A 6: 133,531,242 noncoding transcript Het
Gm8674 G A 13: 49,902,438 noncoding transcript Het
Hoxc6 C T 15: 103,009,585 probably benign Het
Ino80 T C 2: 119,392,867 T1189A probably damaging Het
Iqgap1 T C 7: 80,768,457 E55G probably damaging Het
Kcnh2 G A 5: 24,322,762 probably benign Het
Lama1 G A 17: 67,807,923 G2356S probably benign Het
Mdfic T A 6: 15,799,590 probably null Het
Me3 T C 7: 89,786,420 probably benign Het
Mmadhc T C 2: 50,280,326 D258G probably damaging Het
Nfe2 T C 15: 103,249,129 D145G probably damaging Het
Olfr1039 A T 2: 86,131,063 L200Q probably damaging Het
Olfr1200 T C 2: 88,767,805 N170S probably damaging Het
Olfr1377 T A 11: 50,985,218 N172K probably damaging Het
Olfr1391 A G 11: 49,327,693 Y94C probably damaging Het
Olfr1404 C T 1: 173,215,867 T72I probably benign Het
Olfr352 A C 2: 36,870,393 I276L possibly damaging Het
Olfr728 A C 14: 50,140,294 L115R probably damaging Het
P4ha3 A T 7: 100,313,250 D405V possibly damaging Het
Palmd T C 3: 116,923,504 D448G probably damaging Het
Pclo T C 5: 14,679,132 probably benign Het
Pcsk6 A G 7: 65,910,311 probably benign Het
Pidd1 T C 7: 141,440,777 E469G probably damaging Het
Ptpn13 A G 5: 103,536,871 D875G possibly damaging Het
Rasgrf2 A G 13: 91,902,621 L886P probably damaging Het
Scrib G A 15: 76,048,542 R1454C probably damaging Het
Slc24a1 A G 9: 64,948,696 S310P unknown Het
Slc44a5 A G 3: 154,257,714 probably null Het
Snx4 T G 16: 33,286,046 M283R probably damaging Het
Snx7 A T 3: 117,829,573 probably benign Het
Stk19 A T 17: 34,824,598 L212H probably damaging Het
Sult2a4 T C 7: 13,989,495 K32E probably damaging Het
Tfrc T A 16: 32,623,375 Y473N probably damaging Het
Tlr2 C G 3: 83,837,353 L474F probably damaging Het
Tnfrsf4 T A 4: 156,016,162 F213I probably benign Het
Vmn1r84 T A 7: 12,362,533 I78L possibly damaging Het
Vmn2r77 T C 7: 86,811,148 Y561H probably damaging Het
Vmn2r95 A G 17: 18,440,639 probably benign Het
Zfp11 T C 5: 129,658,367 N10S probably benign Het
Zfp81 A T 17: 33,334,783 H352Q probably damaging Het
Zscan5b T A 7: 6,230,375 L66Q probably damaging Het
Other mutations in Trim9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Trim9 APN 12 70347113 missense probably damaging 0.98
IGL01618:Trim9 APN 12 70248351 missense probably benign
IGL01794:Trim9 APN 12 70281880 missense probably damaging 1.00
IGL03101:Trim9 APN 12 70346654 missense probably damaging 1.00
IGL03184:Trim9 APN 12 70251221 missense probably damaging 0.99
E0354:Trim9 UTSW 12 70272459 missense probably benign 0.01
IGL03098:Trim9 UTSW 12 70280693 missense possibly damaging 0.95
R0518:Trim9 UTSW 12 70346585 missense probably damaging 0.99
R0622:Trim9 UTSW 12 70346604 missense probably damaging 1.00
R0941:Trim9 UTSW 12 70248263 missense probably damaging 0.97
R1022:Trim9 UTSW 12 70252017 splice site probably null
R1024:Trim9 UTSW 12 70252017 splice site probably null
R1204:Trim9 UTSW 12 70346727 missense probably damaging 1.00
R1439:Trim9 UTSW 12 70251093 missense probably damaging 1.00
R1530:Trim9 UTSW 12 70272428 missense probably damaging 0.98
R1661:Trim9 UTSW 12 70255113 missense probably damaging 0.99
R1665:Trim9 UTSW 12 70255113 missense probably damaging 0.99
R1722:Trim9 UTSW 12 70248374 missense probably benign 0.33
R2097:Trim9 UTSW 12 70347159 missense probably damaging 1.00
R3082:Trim9 UTSW 12 70255113 missense possibly damaging 0.93
R3123:Trim9 UTSW 12 70248393 missense probably damaging 1.00
R3124:Trim9 UTSW 12 70248393 missense probably damaging 1.00
R3125:Trim9 UTSW 12 70248393 missense probably damaging 1.00
R3738:Trim9 UTSW 12 70251195 missense probably damaging 1.00
R4013:Trim9 UTSW 12 70346352 missense probably damaging 1.00
R4017:Trim9 UTSW 12 70346352 missense probably damaging 1.00
R4560:Trim9 UTSW 12 70347118 nonsense probably null
R4734:Trim9 UTSW 12 70248273 missense probably damaging 1.00
R4748:Trim9 UTSW 12 70248273 missense probably damaging 1.00
R4749:Trim9 UTSW 12 70248273 missense probably damaging 1.00
R4777:Trim9 UTSW 12 70347071 missense probably damaging 1.00
R5027:Trim9 UTSW 12 70346708 missense probably damaging 0.96
R5451:Trim9 UTSW 12 70346829 missense probably benign 0.17
R5471:Trim9 UTSW 12 70346792 missense possibly damaging 0.93
R6394:Trim9 UTSW 12 70255213 missense possibly damaging 0.91
R6901:Trim9 UTSW 12 70346639 missense probably damaging 0.96
R7549:Trim9 UTSW 12 70346941 missense probably damaging 1.00
R7690:Trim9 UTSW 12 70248343 missense probably benign
R7895:Trim9 UTSW 12 70255187 missense probably benign 0.03
R7978:Trim9 UTSW 12 70255187 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGCAGCCAGTCTGTTGAAGTCATTC -3'
(R):5'- GGTAAAAGCCAGCGGCAAACTC -3'

Sequencing Primer
(F):5'- CTGTTGAAGTCATTCAGGTCTAC -3'
(R):5'- CTCACCTACTATACATGGGGC -3'
Posted On2014-04-24