Incidental Mutation 'R1613:Scrib'
ID176956
Institutional Source Beutler Lab
Gene Symbol Scrib
Ensembl Gene ENSMUSG00000022568
Gene Namescribbled planar cell polarity
SynonymsScrb1, Crc
MMRRC Submission 039650-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1613 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76047158-76069784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 76048542 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 1454 (R1454C)
Ref Sequence ENSEMBL: ENSMUSP00000105572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002603] [ENSMUST00000063747] [ENSMUST00000109946] [ENSMUST00000145830] [ENSMUST00000148211] [ENSMUST00000187868]
Predicted Effect probably damaging
Transcript: ENSMUST00000002603
AA Change: R1482C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002603
Gene: ENSMUSG00000022568
AA Change: R1482C

DomainStartEndE-ValueType
LRR 58 80 1.99e0 SMART
LRR 81 104 2.54e2 SMART
LRR 127 149 3.56e2 SMART
LRR 150 172 2.33e1 SMART
LRR 173 195 2.45e0 SMART
LRR_TYP 196 218 7.78e-3 SMART
LRR 219 241 7.79e0 SMART
LRR 242 265 1.41e0 SMART
LRR 288 310 2.47e2 SMART
LRR_TYP 311 334 2.36e-2 SMART
LRR 335 356 7.8e1 SMART
LRR 357 380 1.22e2 SMART
low complexity region 455 466 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
coiled coil region 653 685 N/A INTRINSIC
PDZ 722 801 2e-23 SMART
low complexity region 822 837 N/A INTRINSIC
PDZ 856 936 1.23e-23 SMART
low complexity region 941 965 N/A INTRINSIC
low complexity region 968 978 N/A INTRINSIC
PDZ 998 1079 6.7e-25 SMART
PDZ 1095 1178 3.88e-21 SMART
low complexity region 1306 1321 N/A INTRINSIC
coiled coil region 1390 1420 N/A INTRINSIC
low complexity region 1452 1464 N/A INTRINSIC
low complexity region 1498 1515 N/A INTRINSIC
low complexity region 1549 1560 N/A INTRINSIC
low complexity region 1648 1665 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000063747
AA Change: R1454C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068056
Gene: ENSMUSG00000022568
AA Change: R1454C

DomainStartEndE-ValueType
LRR 58 80 1.99e0 SMART
LRR 81 104 2.54e2 SMART
LRR 127 149 3.56e2 SMART
LRR 150 172 2.33e1 SMART
LRR 173 195 2.45e0 SMART
LRR_TYP 196 218 7.78e-3 SMART
LRR 219 241 7.79e0 SMART
LRR 242 265 1.41e0 SMART
LRR 288 310 2.47e2 SMART
LRR_TYP 311 334 2.36e-2 SMART
LRR 335 356 7.8e1 SMART
LRR 357 380 1.22e2 SMART
low complexity region 455 466 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
coiled coil region 653 685 N/A INTRINSIC
PDZ 722 801 2e-23 SMART
low complexity region 822 837 N/A INTRINSIC
PDZ 856 936 1.23e-23 SMART
low complexity region 941 965 N/A INTRINSIC
low complexity region 968 978 N/A INTRINSIC
PDZ 998 1079 6.7e-25 SMART
PDZ 1095 1178 3.88e-21 SMART
low complexity region 1282 1293 N/A INTRINSIC
coiled coil region 1362 1392 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1595 1612 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109946
AA Change: R1454C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105572
Gene: ENSMUSG00000022568
AA Change: R1454C

DomainStartEndE-ValueType
LRR 58 80 1.99e0 SMART
LRR 81 104 2.54e2 SMART
LRR 127 149 3.56e2 SMART
LRR 150 172 2.33e1 SMART
LRR 173 195 2.45e0 SMART
LRR_TYP 196 218 7.78e-3 SMART
LRR 219 241 7.79e0 SMART
LRR 242 265 1.41e0 SMART
LRR 288 310 2.47e2 SMART
LRR_TYP 311 334 2.36e-2 SMART
LRR 335 356 7.8e1 SMART
LRR 357 380 1.22e2 SMART
low complexity region 455 466 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
coiled coil region 653 685 N/A INTRINSIC
PDZ 722 801 2e-23 SMART
low complexity region 822 837 N/A INTRINSIC
PDZ 856 936 1.23e-23 SMART
low complexity region 941 965 N/A INTRINSIC
low complexity region 968 978 N/A INTRINSIC
PDZ 998 1079 6.7e-25 SMART
PDZ 1095 1178 3.88e-21 SMART
low complexity region 1282 1293 N/A INTRINSIC
coiled coil region 1362 1392 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1620 1637 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136390
SMART Domains Protein: ENSMUSP00000119097
Gene: ENSMUSG00000022568

DomainStartEndE-ValueType
PDZ 27 106 2e-23 SMART
low complexity region 127 142 N/A INTRINSIC
PDZ 161 241 1.23e-23 SMART
low complexity region 246 270 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
PDZ 303 384 6.7e-25 SMART
PDZ 400 483 3.88e-21 SMART
low complexity region 611 626 N/A INTRINSIC
coiled coil region 694 724 N/A INTRINSIC
low complexity region 757 769 N/A INTRINSIC
low complexity region 803 820 N/A INTRINSIC
low complexity region 854 865 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145830
SMART Domains Protein: ENSMUSP00000115329
Gene: ENSMUSG00000022568

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148211
SMART Domains Protein: ENSMUSP00000114573
Gene: ENSMUSG00000022568

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229940
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230217
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231218
Meta Mutation Damage Score 0.2741 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency 82% (69/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified as being similar to the Drosophila scribble protein. The mammalian protein is involved in tumor suppression pathways. As a scaffold protein involved in cell polarization processes, this protein binds to many other proteins. The encoded protein binds to papillomavirus E6 protein via its PDZ domain and the C-terminus of E6. Two alternatively spliced transcript variants that encode different protein isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele display partial prenatal lethality. Mice homozygous for spontaneous or induced alleles exhibit craniofacial or neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrp G T 8: 105,566,835 T106K probably damaging Het
Aldh3a1 A T 11: 61,214,551 D161V probably damaging Het
Aloxe3 A G 11: 69,130,046 D199G possibly damaging Het
Amfr T A 8: 93,999,226 M176L probably benign Het
Amigo1 A T 3: 108,188,220 E345V probably benign Het
Atp13a3 T C 16: 30,332,300 Y1064C probably damaging Het
AU019823 T C 9: 50,607,805 K169R probably damaging Het
Brd7 A T 8: 88,346,950 C271S probably benign Het
Bub1b T A 2: 118,639,741 probably null Het
Ccdc146 T A 5: 21,294,524 I887F probably damaging Het
Ceacam14 T C 7: 17,814,048 probably benign Het
Cntn1 T A 15: 92,245,990 V278E possibly damaging Het
Col6a6 A C 9: 105,732,211 probably null Het
Cspp1 C T 1: 10,133,241 R1016C probably damaging Het
Cyp2c39 A G 19: 39,539,011 Y267C probably damaging Het
Cyp2c67 C T 19: 39,626,199 V295I probably benign Het
Cyp2d40 T C 15: 82,761,439 T122A unknown Het
Dmxl2 A G 9: 54,382,027 I2541T probably benign Het
Eif3e G A 15: 43,250,224 A438V possibly damaging Het
Fam178b C A 1: 36,600,192 W342L probably benign Het
Fam45a T A 19: 60,822,325 V171D possibly damaging Het
Fam78a G T 2: 32,069,569 N176K probably damaging Het
Ghrhr A T 6: 55,379,697 K93M probably damaging Het
Gm1527 T A 3: 28,898,853 probably null Het
Gm1553 G A 10: 82,492,596 probably benign Het
Gm5885 G A 6: 133,531,242 noncoding transcript Het
Gm8674 G A 13: 49,902,438 noncoding transcript Het
Hoxc6 C T 15: 103,009,585 probably benign Het
Ino80 T C 2: 119,392,867 T1189A probably damaging Het
Iqgap1 T C 7: 80,768,457 E55G probably damaging Het
Kcnh2 G A 5: 24,322,762 probably benign Het
Lama1 G A 17: 67,807,923 G2356S probably benign Het
Mdfic T A 6: 15,799,590 probably null Het
Me3 T C 7: 89,786,420 probably benign Het
Mmadhc T C 2: 50,280,326 D258G probably damaging Het
Nfe2 T C 15: 103,249,129 D145G probably damaging Het
Olfr1039 A T 2: 86,131,063 L200Q probably damaging Het
Olfr1200 T C 2: 88,767,805 N170S probably damaging Het
Olfr1377 T A 11: 50,985,218 N172K probably damaging Het
Olfr1391 A G 11: 49,327,693 Y94C probably damaging Het
Olfr1404 C T 1: 173,215,867 T72I probably benign Het
Olfr352 A C 2: 36,870,393 I276L possibly damaging Het
Olfr728 A C 14: 50,140,294 L115R probably damaging Het
P4ha3 A T 7: 100,313,250 D405V possibly damaging Het
Palmd T C 3: 116,923,504 D448G probably damaging Het
Pclo T C 5: 14,679,132 probably benign Het
Pcsk6 A G 7: 65,910,311 probably benign Het
Pidd1 T C 7: 141,440,777 E469G probably damaging Het
Ptpn13 A G 5: 103,536,871 D875G possibly damaging Het
Rasgrf2 A G 13: 91,902,621 L886P probably damaging Het
Slc24a1 A G 9: 64,948,696 S310P unknown Het
Slc44a5 A G 3: 154,257,714 probably null Het
Snx4 T G 16: 33,286,046 M283R probably damaging Het
Snx7 A T 3: 117,829,573 probably benign Het
Stk19 A T 17: 34,824,598 L212H probably damaging Het
Sult2a4 T C 7: 13,989,495 K32E probably damaging Het
Tfrc T A 16: 32,623,375 Y473N probably damaging Het
Tlr2 C G 3: 83,837,353 L474F probably damaging Het
Tnfrsf4 T A 4: 156,016,162 F213I probably benign Het
Trim9 A T 12: 70,248,395 I651N probably damaging Het
Vmn1r84 T A 7: 12,362,533 I78L possibly damaging Het
Vmn2r77 T C 7: 86,811,148 Y561H probably damaging Het
Vmn2r95 A G 17: 18,440,639 probably benign Het
Zfp11 T C 5: 129,658,367 N10S probably benign Het
Zfp81 A T 17: 33,334,783 H352Q probably damaging Het
Zscan5b T A 7: 6,230,375 L66Q probably damaging Het
Other mutations in Scrib
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Scrib APN 15 76048794 missense possibly damaging 0.49
IGL00905:Scrib APN 15 76064990 missense probably damaging 0.96
IGL01529:Scrib APN 15 76049235 missense possibly damaging 0.66
IGL01896:Scrib APN 15 76066118 missense possibly damaging 0.75
IGL01947:Scrib APN 15 76061767 missense probably benign 0.01
IGL02219:Scrib APN 15 76065036 nonsense probably null
IGL02372:Scrib APN 15 76048255 missense probably damaging 0.99
IGL02880:Scrib APN 15 76066124 missense probably damaging 1.00
IGL02959:Scrib APN 15 76065207 missense probably damaging 0.99
R0605:Scrib UTSW 15 76067553 missense possibly damaging 0.89
R0711:Scrib UTSW 15 76066907 unclassified probably benign
R0757:Scrib UTSW 15 76062750 small deletion probably benign
R0903:Scrib UTSW 15 76066855 missense possibly damaging 0.95
R0959:Scrib UTSW 15 76051461 missense probably benign 0.34
R1483:Scrib UTSW 15 76057922 missense probably damaging 1.00
R1551:Scrib UTSW 15 76065162 missense probably damaging 1.00
R1604:Scrib UTSW 15 76048240 missense probably damaging 0.97
R1615:Scrib UTSW 15 76066205 missense probably benign 0.39
R1681:Scrib UTSW 15 76064567 missense probably damaging 1.00
R3110:Scrib UTSW 15 76069374 missense probably damaging 0.98
R3112:Scrib UTSW 15 76069374 missense probably damaging 0.98
R4050:Scrib UTSW 15 76051473 missense possibly damaging 0.91
R4660:Scrib UTSW 15 76065336 missense probably damaging 0.98
R4976:Scrib UTSW 15 76051753 critical splice donor site probably null
R5119:Scrib UTSW 15 76051753 critical splice donor site probably null
R5243:Scrib UTSW 15 76065252 missense probably benign 0.00
R5246:Scrib UTSW 15 76064797 missense probably benign 0.19
R5483:Scrib UTSW 15 76067659 critical splice donor site probably null
R5516:Scrib UTSW 15 76062863 missense possibly damaging 0.50
R5628:Scrib UTSW 15 76049540 missense possibly damaging 0.66
R5787:Scrib UTSW 15 76059302 missense probably damaging 1.00
R5894:Scrib UTSW 15 76067732 missense probably damaging 0.99
R6005:Scrib UTSW 15 76057751 missense probably damaging 1.00
R6041:Scrib UTSW 15 76067172 missense possibly damaging 0.93
R6351:Scrib UTSW 15 76064986 missense possibly damaging 0.65
R6603:Scrib UTSW 15 76062723 missense probably benign 0.00
R7298:Scrib UTSW 15 76064761 missense probably damaging 1.00
R7344:Scrib UTSW 15 76049258 missense probably damaging 1.00
R7428:Scrib UTSW 15 76061198 missense probably damaging 1.00
R7486:Scrib UTSW 15 76057650 missense probably damaging 1.00
Z1088:Scrib UTSW 15 76048231 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCAAAGAGGATGCTGCTGACTG -3'
(R):5'- GGAGCAATGACCTAGCCTTGTCTG -3'

Sequencing Primer
(F):5'- ATGCTGCTGACTGGACCTTG -3'
(R):5'- CAATGACCTAGCCTTGTCTGATATG -3'
Posted On2014-04-24