Incidental Mutation 'R1614:Nabp1'
ID176972
Institutional Source Beutler Lab
Gene Symbol Nabp1
Ensembl Gene ENSMUSG00000026107
Gene Namenucleic acid binding protein 1
Synonyms4933440J18Rik, Nbp1, 4930442A21Rik, Obfc2a, 4930434H03Rik, Ssb2, 5830411E10Rik, 4930488J04Rik
MMRRC Submission 039651-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R1614 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location51465862-51478425 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51471352 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 164 (N164D)
Ref Sequence ENSEMBL: ENSMUSP00000140556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027279] [ENSMUST00000185534] [ENSMUST00000186003] [ENSMUST00000186684] [ENSMUST00000188051] [ENSMUST00000188204] [ENSMUST00000189542] [ENSMUST00000190103]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027279
AA Change: N164D

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000027279
Gene: ENSMUSG00000026107
AA Change: N164D

DomainStartEndE-ValueType
PDB:4OWX|B 10 142 2e-72 PDB
SCOP:d1fgua1 11 84 3e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000185534
AA Change: N84D

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140557
Gene: ENSMUSG00000026107
AA Change: N84D

DomainStartEndE-ValueType
PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185961
Predicted Effect possibly damaging
Transcript: ENSMUST00000186003
AA Change: N84D

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140126
Gene: ENSMUSG00000026107
AA Change: N84D

DomainStartEndE-ValueType
PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000186684
AA Change: N84D

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140179
Gene: ENSMUSG00000026107
AA Change: N84D

DomainStartEndE-ValueType
PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000188051
AA Change: N84D

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139853
Gene: ENSMUSG00000026107
AA Change: N84D

DomainStartEndE-ValueType
PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000188204
AA Change: N84D

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140469
Gene: ENSMUSG00000026107
AA Change: N84D

DomainStartEndE-ValueType
PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188303
Predicted Effect possibly damaging
Transcript: ENSMUST00000189542
AA Change: N84D

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140059
Gene: ENSMUSG00000026107
AA Change: N84D

DomainStartEndE-ValueType
PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000190103
AA Change: N164D

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140556
Gene: ENSMUSG00000026107
AA Change: N164D

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 27 108 2.8e-7 PFAM
Meta Mutation Damage Score 0.0725 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Single-stranded DNA (ssDNA)-binding proteins, such as OBFC2A, are ubiquitous and essential for a variety of DNA metabolic processes, including replication, recombination, and detection and repair of damage (Richard et al., 2008 [PubMed 18449195]).[supplied by OMIM, Jun 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik T G 11: 85,172,864 S28A possibly damaging Het
Arl9 A G 5: 77,010,565 T165A probably benign Het
Atpaf1 A T 4: 115,796,757 K201N possibly damaging Het
Cacna1b G T 2: 24,690,807 Q676K possibly damaging Het
Ccdc88c A T 12: 100,912,984 H1959Q probably benign Het
Cep162 T C 9: 87,212,932 D808G probably damaging Het
Chtf18 A G 17: 25,727,090 L42P probably benign Het
Cox7c A G 13: 86,045,785 F40L probably benign Het
Dock7 C T 4: 99,061,280 V442I probably benign Het
Dst T C 1: 34,275,263 F4198S probably damaging Het
Fam13a T A 6: 58,940,184 D569V probably damaging Het
Gm6741 T A 17: 91,236,996 H62Q probably benign Het
Gnptab A G 10: 88,414,589 T172A probably benign Het
Greb1 A G 12: 16,701,171 S1013P probably damaging Het
Insl5 A T 4: 103,026,649 L25* probably null Het
Ipo13 A G 4: 117,904,618 S462P probably benign Het
Itgb1 G A 8: 128,720,065 C401Y probably damaging Het
Kcnh7 G T 2: 62,850,604 A213E probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Nop53 A G 7: 15,945,965 V30A probably benign Het
Olfr1246 T A 2: 89,590,696 I140L possibly damaging Het
Olfr1278 T A 2: 111,293,066 V266E probably damaging Het
Olfr1318 T A 2: 112,156,517 C189S probably damaging Het
Olfr346 T G 2: 36,688,309 Y102* probably null Het
Pcsk5 G A 19: 17,515,256 R918C probably damaging Het
Pecam1 T C 11: 106,681,079 D554G probably benign Het
Polr2a T C 11: 69,743,373 I744V possibly damaging Het
Pop1 C A 15: 34,530,210 A918D possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prmt3 A T 7: 49,826,719 I359F possibly damaging Het
Proz G A 8: 13,066,904 C152Y probably damaging Het
Ptgfr A C 3: 151,801,779 Y316D probably benign Het
Ralgapa2 G T 2: 146,388,612 S1011Y probably damaging Het
Rnf43 C T 11: 87,731,659 R529* probably null Het
Slc17a6 G A 7: 51,646,277 probably benign Het
Slc25a19 A T 11: 115,616,623 C224* probably null Het
Smarcd3 A G 5: 24,594,876 S299P possibly damaging Het
Stard9 T C 2: 120,697,675 F1471S possibly damaging Het
Strada A C 11: 106,168,319 V211G probably damaging Het
Tom1l1 T C 11: 90,683,254 E68G probably damaging Het
Vmn2r27 T G 6: 124,223,934 I355L probably benign Het
Vmn2r68 A T 7: 85,221,738 M779K possibly damaging Het
Zbtb18 T C 1: 177,447,170 L23P probably damaging Het
Zfp112 G T 7: 24,126,599 C664F probably damaging Het
Zfp955a A T 17: 33,242,332 N275K possibly damaging Het
Other mutations in Nabp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Nabp1 APN 1 51477528 missense probably damaging 1.00
kinkajou UTSW 1 51471352 missense possibly damaging 0.70
R0898:Nabp1 UTSW 1 51471337 missense probably benign
R1608:Nabp1 UTSW 1 51473003 splice site probably null
R1956:Nabp1 UTSW 1 51477845 missense probably damaging 0.96
R2208:Nabp1 UTSW 1 51477614 nonsense probably null
R4632:Nabp1 UTSW 1 51474602 nonsense probably null
R5996:Nabp1 UTSW 1 51471385 missense probably benign 0.00
R6754:Nabp1 UTSW 1 51474540 missense probably damaging 0.97
R7322:Nabp1 UTSW 1 51473070 missense probably damaging 0.98
R8251:Nabp1 UTSW 1 51477578 missense probably benign 0.04
R8302:Nabp1 UTSW 1 51472339 missense probably benign 0.00
X0063:Nabp1 UTSW 1 51477849 missense probably benign 0.00
Z1176:Nabp1 UTSW 1 51477725 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGCTGGTGTCTTAAGTAACTCACCCTC -3'
(R):5'- GTTAATACACTTGTCCAGCCCAGAGC -3'

Sequencing Primer
(F):5'- GGACAGGTTTTCAAGTGATACCC -3'
(R):5'- AGAATAAAAGTGCTGGTTTTTCCTGG -3'
Posted On2014-04-24