Mutagenetix > Incidental Mutations

Incidental Mutation 'R1614:Ralgapa2'

176984

Institutional Source

Beutler Lab

Gene Symbol

Ralgapa2

Ensembl Gene

ENSMUSG00000037110

Gene Name

Ral GTPase activating protein, alpha subunit 2 (catalytic)

Synonyms

AS250, RGC2, A230067G21Rik

MMRRC Submission

039651-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.266) question?

Stock #

R1614 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

146239879-146512344 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 146388612 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Tyrosine at position 1011 (S1011Y)

Ref Sequence

ENSEMBL: ENSMUSP00000153734 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109986] [ENSMUST00000131824] [ENSMUST00000228797]

Predicted Effect

probably damaging
Transcript: ENSMUST00000109986
AA Change: S964Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000105613
Gene: ENSMUSG00000037110
AA Change: S964Y

Domain	Start	End	E-Value	Type
low complexity region	469	480	N/A	INTRINSIC
low complexity region	1017	1028	N/A	INTRINSIC
low complexity region	1296	1301	N/A	INTRINSIC
Pfam:Rap_GAP	1701	1877	6.8e-48	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000131824
AA Change: S926Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000122039
Gene: ENSMUSG00000037110
AA Change: S926Y

Domain	Start	End	E-Value	Type
low complexity region	469	480	N/A	INTRINSIC
low complexity region	979	990	N/A	INTRINSIC
low complexity region	1258	1263	N/A	INTRINSIC
Pfam:Rap_GAP	1663	1842	1.3e-66	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000146307

SMART Domains

Protein: ENSMUSP00000114547
Gene: ENSMUSG00000037110

Domain	Start	End	E-Value	Type
low complexity region	6	17	N/A	INTRINSIC
low complexity region	285	290	N/A	INTRINSIC
Pfam:Rap_GAP	690	830	4.9e-39	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148784

Predicted Effect

unknown
Transcript: ENSMUST00000149499
AA Change: S596Y

SMART Domains

Protein: ENSMUSP00000122017
Gene: ENSMUSG00000037110
AA Change: S596Y

Domain	Start	End	E-Value	Type
low complexity region	140	151	N/A	INTRINSIC
low complexity region	650	661	N/A	INTRINSIC
low complexity region	929	934	N/A	INTRINSIC
Pfam:Rap_GAP	1334	1511	2.4e-48	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000228797
AA Change: S1011Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.2658

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.4%
20x: 89.4%

Validation Efficiency

100% (53/53)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased incidence and severity of induced urothelial bladder tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700125H20Rik	T	G	11: 85,172,864	S28A	possibly damaging	Het
Arl9	A	G	5: 77,010,565	T165A	probably benign	Het
Atpaf1	A	T	4: 115,796,757	K201N	possibly damaging	Het
Cacna1b	G	T	2: 24,690,807	Q676K	possibly damaging	Het
Ccdc88c	A	T	12: 100,912,984	H1959Q	probably benign	Het
Cep162	T	C	9: 87,212,932	D808G	probably damaging	Het
Chtf18	A	G	17: 25,727,090	L42P	probably benign	Het
Cox7c	A	G	13: 86,045,785	F40L	probably benign	Het
Dock7	C	T	4: 99,061,280	V442I	probably benign	Het
Dst	T	C	1: 34,275,263	F4198S	probably damaging	Het
Fam13a	T	A	6: 58,940,184	D569V	probably damaging	Het
Gm6741	T	A	17: 91,236,996	H62Q	probably benign	Het
Gnptab	A	G	10: 88,414,589	T172A	probably benign	Het
Greb1	A	G	12: 16,701,171	S1013P	probably damaging	Het
Insl5	A	T	4: 103,026,649	L25*	probably null	Het
Ipo13	A	G	4: 117,904,618	S462P	probably benign	Het
Itgb1	G	A	8: 128,720,065	C401Y	probably damaging	Het
Kcnh7	G	T	2: 62,850,604	A213E	probably benign	Het
Kcnv1	G	A	15: 45,114,444	T66M	probably damaging	Het
Mesp2	T	C	7: 79,811,619	S231P	probably benign	Het
Nabp1	T	C	1: 51,471,352	N164D	possibly damaging	Het
Nop53	A	G	7: 15,945,965	V30A	probably benign	Het
Olfr1246	T	A	2: 89,590,696	I140L	possibly damaging	Het
Olfr1278	T	A	2: 111,293,066	V266E	probably damaging	Het
Olfr1318	T	A	2: 112,156,517	C189S	probably damaging	Het
Olfr346	T	G	2: 36,688,309	Y102*	probably null	Het
Pcsk5	G	A	19: 17,515,256	R918C	probably damaging	Het
Pecam1	T	C	11: 106,681,079	D554G	probably benign	Het
Polr2a	T	C	11: 69,743,373	I744V	possibly damaging	Het
Pop1	C	A	15: 34,530,210	A918D	possibly damaging	Het
Ppp2r5e	C	G	12: 75,469,567	A239P	probably damaging	Het
Prmt3	A	T	7: 49,826,719	I359F	possibly damaging	Het
Proz	G	A	8: 13,066,904	C152Y	probably damaging	Het
Ptgfr	A	C	3: 151,801,779	Y316D	probably benign	Het
Rnf43	C	T	11: 87,731,659	R529*	probably null	Het
Slc17a6	G	A	7: 51,646,277		probably benign	Het
Slc25a19	A	T	11: 115,616,623	C224*	probably null	Het
Smarcd3	A	G	5: 24,594,876	S299P	possibly damaging	Het
Stard9	T	C	2: 120,697,675	F1471S	possibly damaging	Het
Strada	A	C	11: 106,168,319	V211G	probably damaging	Het
Tom1l1	T	C	11: 90,683,254	E68G	probably damaging	Het
Vmn2r27	T	G	6: 124,223,934	I355L	probably benign	Het
Vmn2r68	A	T	7: 85,221,738	M779K	possibly damaging	Het
Zbtb18	T	C	1: 177,447,170	L23P	probably damaging	Het
Zfp112	G	T	7: 24,126,599	C664F	probably damaging	Het
Zfp955a	A	T	17: 33,242,332	N275K	possibly damaging	Het

Other mutations in Ralgapa2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00666:Ralgapa2	APN	2	146485136	missense	possibly damaging	0.61
IGL00915:Ralgapa2	APN	2	146342522	missense	probably damaging	1.00
IGL01012:Ralgapa2	APN	2	146421739	missense	possibly damaging	0.95
IGL01018:Ralgapa2	APN	2	146410193	missense	probably benign	0.02
IGL01018:Ralgapa2	APN	2	146410192	missense	probably benign	0.00
IGL01902:Ralgapa2	APN	2	146315014	missense	probably damaging	1.00
IGL02160:Ralgapa2	APN	2	146348440	splice site	probably benign
IGL02321:Ralgapa2	APN	2	146412816	nonsense	probably null
IGL02412:Ralgapa2	APN	2	146412132	missense	probably damaging	0.96
IGL03026:Ralgapa2	APN	2	146460775	splice site	probably benign
IGL03115:Ralgapa2	APN	2	146424814	missense	probably damaging	0.99
IGL03256:Ralgapa2	APN	2	146460712	critical splice donor site	probably null
IGL03379:Ralgapa2	APN	2	146357987	missense	probably benign	0.01
Chow	UTSW	2	146346718	nonsense	probably null
purina	UTSW	2	146333486	missense	probably damaging	1.00
P4748:Ralgapa2	UTSW	2	146346811	nonsense	probably null
R0012:Ralgapa2	UTSW	2	146412752	missense	probably benign
R0012:Ralgapa2	UTSW	2	146412752	missense	probably benign
R0165:Ralgapa2	UTSW	2	146388487	splice site	probably benign
R0344:Ralgapa2	UTSW	2	146346794	missense	possibly damaging	0.69
R0402:Ralgapa2	UTSW	2	146434809	missense	probably damaging	0.98
R0419:Ralgapa2	UTSW	2	146428672	missense	possibly damaging	0.69
R0638:Ralgapa2	UTSW	2	146342192	missense	probably benign	0.00
R0704:Ralgapa2	UTSW	2	146451784	missense	probably damaging	1.00
R0722:Ralgapa2	UTSW	2	146388531	missense	probably damaging	1.00
R0866:Ralgapa2	UTSW	2	146436003	missense	probably damaging	1.00
R1065:Ralgapa2	UTSW	2	146450558	missense	probably benign	0.00
R1212:Ralgapa2	UTSW	2	146357982	missense	probably benign	0.00
R1395:Ralgapa2	UTSW	2	146388500	missense	probably damaging	1.00
R1686:Ralgapa2	UTSW	2	146358000	missense	probably benign	0.09
R1799:Ralgapa2	UTSW	2	146342728	missense	probably benign	0.02
R1905:Ralgapa2	UTSW	2	146387701	missense	probably damaging	1.00
R1956:Ralgapa2	UTSW	2	146460759	missense	probably benign	0.00
R2144:Ralgapa2	UTSW	2	146388604	missense	probably damaging	1.00
R2148:Ralgapa2	UTSW	2	146431887	missense	probably benign	0.02
R2219:Ralgapa2	UTSW	2	146421679	missense	probably benign	0.09
R2220:Ralgapa2	UTSW	2	146421679	missense	probably benign	0.09
R2261:Ralgapa2	UTSW	2	146342683	missense	probably damaging	1.00
R2402:Ralgapa2	UTSW	2	146353192	missense	probably damaging	1.00
R2495:Ralgapa2	UTSW	2	146361400	missense	possibly damaging	0.82
R3752:Ralgapa2	UTSW	2	146421631	missense	possibly damaging	0.94
R3953:Ralgapa2	UTSW	2	146435964	missense	probably damaging	1.00
R3956:Ralgapa2	UTSW	2	146435964	missense	probably damaging	1.00
R4177:Ralgapa2	UTSW	2	146485163	missense	probably damaging	1.00
R4182:Ralgapa2	UTSW	2	146435994	missense	probably damaging	1.00
R4193:Ralgapa2	UTSW	2	146342573	missense	probably damaging	1.00
R4332:Ralgapa2	UTSW	2	146260368	missense	probably benign	0.10
R4507:Ralgapa2	UTSW	2	146353248	missense	probably benign	0.11
R4574:Ralgapa2	UTSW	2	146435999	missense	probably damaging	1.00
R4585:Ralgapa2	UTSW	2	146315024	missense	probably damaging	0.99
R4627:Ralgapa2	UTSW	2	146361453	missense	possibly damaging	0.88
R4647:Ralgapa2	UTSW	2	146387629	missense	possibly damaging	0.69
R4677:Ralgapa2	UTSW	2	146345467	missense	possibly damaging	0.82
R4724:Ralgapa2	UTSW	2	146345533	missense	possibly damaging	0.46
R4760:Ralgapa2	UTSW	2	146346749	missense	probably benign	0.00
R4831:Ralgapa2	UTSW	2	146405067	intron	probably benign
R4962:Ralgapa2	UTSW	2	146434834	nonsense	probably null
R4993:Ralgapa2	UTSW	2	146447311	missense	probably damaging	1.00
R5041:Ralgapa2	UTSW	2	146485151	missense	probably benign	0.00
R5120:Ralgapa2	UTSW	2	146412084	missense	probably benign	0.26
R5185:Ralgapa2	UTSW	2	146388486	splice site	probably null
R5393:Ralgapa2	UTSW	2	146345455	missense	probably damaging	1.00
R5428:Ralgapa2	UTSW	2	146334494	missense	probably damaging	0.96
R5439:Ralgapa2	UTSW	2	146342510	missense	probably benign	0.08
R5476:Ralgapa2	UTSW	2	146447436	missense	probably benign
R5695:Ralgapa2	UTSW	2	146333477	missense	probably damaging	1.00
R5705:Ralgapa2	UTSW	2	146449273	missense	probably damaging	1.00
R5718:Ralgapa2	UTSW	2	146453406	splice site	probably null
R5817:Ralgapa2	UTSW	2	146333486	missense	probably damaging	1.00
R5877:Ralgapa2	UTSW	2	146388569	missense	probably damaging	1.00
R5994:Ralgapa2	UTSW	2	146361453	missense	probably benign	0.00
R6048:Ralgapa2	UTSW	2	146434845	missense	possibly damaging	0.46
R6158:Ralgapa2	UTSW	2	146424676	missense	possibly damaging	0.69
R6169:Ralgapa2	UTSW	2	146450465	missense	probably damaging	1.00
R6280:Ralgapa2	UTSW	2	146342209	missense	probably damaging	1.00
R6301:Ralgapa2	UTSW	2	146327411	missense	possibly damaging	0.94
R6650:Ralgapa2	UTSW	2	146388502	missense	probably damaging	1.00
R6959:Ralgapa2	UTSW	2	146342701	missense	probably damaging	0.98
R7020:Ralgapa2	UTSW	2	146346718	nonsense	probably null
R7035:Ralgapa2	UTSW	2	146511857	missense	probably damaging	1.00
R7167:Ralgapa2	UTSW	2	146348454	missense	probably benign
R7186:Ralgapa2	UTSW	2	146388486	splice site	probably null
R7252:Ralgapa2	UTSW	2	146342751	critical splice acceptor site	probably null
R7266:Ralgapa2	UTSW	2	146334568	missense	probably damaging	1.00
R7371:Ralgapa2	UTSW	2	146347126	missense	probably benign	0.05
R7432:Ralgapa2	UTSW	2	146434856	missense	probably benign	0.41
R7470:Ralgapa2	UTSW	2	146424667	missense	probably damaging	1.00
R7663:Ralgapa2	UTSW	2	146418415	missense	probably benign	0.01
R7780:Ralgapa2	UTSW	2	146342414	missense	probably benign	0.14
R7973:Ralgapa2	UTSW	2	146388561	missense	possibly damaging	0.88
R8018:Ralgapa2	UTSW	2	146340391	missense	probably damaging	1.00
R8063:Ralgapa2	UTSW	2	146443855	missense	probably damaging	1.00
R8070:Ralgapa2	UTSW	2	146353279	missense	probably damaging	0.98
R8264:Ralgapa2	UTSW	2	146333450	missense	possibly damaging	0.90
R8309:Ralgapa2	UTSW	2	146404866	missense	possibly damaging	0.66
R8409:Ralgapa2	UTSW	2	146244977	missense
R8474:Ralgapa2	UTSW	2	146424830	missense	probably damaging	1.00
R8487:Ralgapa2	UTSW	2	146388543	missense	probably damaging	1.00
R8492:Ralgapa2	UTSW	2	146342604	missense	possibly damaging	0.50
RF019:Ralgapa2	UTSW	2	146361503	missense	possibly damaging	0.53
X0019:Ralgapa2	UTSW	2	146388652	missense	possibly damaging	0.56
Z1088:Ralgapa2	UTSW	2	146434905	missense	probably benign	0.20

Predicted Primers

PCR Primer
(F):5'- TGAACACCTAGAGAGATTCTGAACCCC -3'
(R):5'- CCAACCAACACAGATGTTTCTGTACCC -3'

Sequencing Primer
(F):5'- GGACTAAATGAAATAACTCTCAGGC -3'
(R):5'- TGTACCCTAAGACTCTGGGTCG -3'

Posted On

2014-04-24