Incidental Mutation 'R1614:Atpaf1'
ID176988
Institutional Source Beutler Lab
Gene Symbol Atpaf1
Ensembl Gene ENSMUSG00000028710
Gene NameATP synthase mitochondrial F1 complex assembly factor 1
Synonyms6330547J17Rik, ATP11p, ATP11
MMRRC Submission 039651-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.679) question?
Stock #R1614 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location115784812-115818828 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115796757 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 201 (K201N)
Ref Sequence ENSEMBL: ENSMUSP00000135831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000137401] [ENSMUST00000175725] [ENSMUST00000176047] [ENSMUST00000176192] [ENSMUST00000177280]
Predicted Effect probably benign
Transcript: ENSMUST00000137401
SMART Domains Protein: ENSMUSP00000135490
Gene: ENSMUSG00000028710

DomainStartEndE-ValueType
Pfam:ATP11 1 60 4.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175725
AA Change: K60N

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000135073
Gene: ENSMUSG00000028710
AA Change: K60N

DomainStartEndE-ValueType
Pfam:ATP11 1 189 2.5e-69 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000176047
AA Change: K201N

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135831
Gene: ENSMUSG00000028710
AA Change: K201N

DomainStartEndE-ValueType
low complexity region 9 39 N/A INTRINSIC
Pfam:ATP11 91 329 2.7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176192
AA Change: K18N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000177280
AA Change: K184N

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135214
Gene: ENSMUSG00000028710
AA Change: K184N

DomainStartEndE-ValueType
low complexity region 9 39 N/A INTRINSIC
Pfam:ATP11 89 212 7.3e-32 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000184179
AA Change: K123N
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an assembly factor for the F(1) component of the mitochondrial ATP synthase. This protein binds specifically to the F1 beta subunit and is thought to prevent this subunit from forming nonproductive homooligomers during enzyme assembly. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik T G 11: 85,172,864 S28A possibly damaging Het
Arl9 A G 5: 77,010,565 T165A probably benign Het
Cacna1b G T 2: 24,690,807 Q676K possibly damaging Het
Ccdc88c A T 12: 100,912,984 H1959Q probably benign Het
Cep162 T C 9: 87,212,932 D808G probably damaging Het
Chtf18 A G 17: 25,727,090 L42P probably benign Het
Cox7c A G 13: 86,045,785 F40L probably benign Het
Dock7 C T 4: 99,061,280 V442I probably benign Het
Dst T C 1: 34,275,263 F4198S probably damaging Het
Fam13a T A 6: 58,940,184 D569V probably damaging Het
Gm6741 T A 17: 91,236,996 H62Q probably benign Het
Gnptab A G 10: 88,414,589 T172A probably benign Het
Greb1 A G 12: 16,701,171 S1013P probably damaging Het
Insl5 A T 4: 103,026,649 L25* probably null Het
Ipo13 A G 4: 117,904,618 S462P probably benign Het
Itgb1 G A 8: 128,720,065 C401Y probably damaging Het
Kcnh7 G T 2: 62,850,604 A213E probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Nabp1 T C 1: 51,471,352 N164D possibly damaging Het
Nop53 A G 7: 15,945,965 V30A probably benign Het
Olfr1246 T A 2: 89,590,696 I140L possibly damaging Het
Olfr1278 T A 2: 111,293,066 V266E probably damaging Het
Olfr1318 T A 2: 112,156,517 C189S probably damaging Het
Olfr346 T G 2: 36,688,309 Y102* probably null Het
Pcsk5 G A 19: 17,515,256 R918C probably damaging Het
Pecam1 T C 11: 106,681,079 D554G probably benign Het
Polr2a T C 11: 69,743,373 I744V possibly damaging Het
Pop1 C A 15: 34,530,210 A918D possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prmt3 A T 7: 49,826,719 I359F possibly damaging Het
Proz G A 8: 13,066,904 C152Y probably damaging Het
Ptgfr A C 3: 151,801,779 Y316D probably benign Het
Ralgapa2 G T 2: 146,388,612 S1011Y probably damaging Het
Rnf43 C T 11: 87,731,659 R529* probably null Het
Slc17a6 G A 7: 51,646,277 probably benign Het
Slc25a19 A T 11: 115,616,623 C224* probably null Het
Smarcd3 A G 5: 24,594,876 S299P possibly damaging Het
Stard9 T C 2: 120,697,675 F1471S possibly damaging Het
Strada A C 11: 106,168,319 V211G probably damaging Het
Tom1l1 T C 11: 90,683,254 E68G probably damaging Het
Vmn2r27 T G 6: 124,223,934 I355L probably benign Het
Vmn2r68 A T 7: 85,221,738 M779K possibly damaging Het
Zbtb18 T C 1: 177,447,170 L23P probably damaging Het
Zfp112 G T 7: 24,126,599 C664F probably damaging Het
Zfp955a A T 17: 33,242,332 N275K possibly damaging Het
Other mutations in Atpaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02529:Atpaf1 APN 4 115791269 missense probably damaging 1.00
IGL03122:Atpaf1 APN 4 115791278 missense probably damaging 1.00
R0396:Atpaf1 UTSW 4 115785252 missense possibly damaging 0.58
R0924:Atpaf1 UTSW 4 115795438 missense probably damaging 1.00
R1462:Atpaf1 UTSW 4 115784953 unclassified probably benign
R1637:Atpaf1 UTSW 4 115788302 missense probably benign 0.00
R2180:Atpaf1 UTSW 4 115788360 start codon destroyed probably null 0.03
R4290:Atpaf1 UTSW 4 115788359 missense probably benign 0.02
R4293:Atpaf1 UTSW 4 115788359 missense probably benign 0.02
R7291:Atpaf1 UTSW 4 115811091 missense probably damaging 1.00
R7423:Atpaf1 UTSW 4 115790630 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTGTAGCAATGAGCAGCAAAGC -3'
(R):5'- ACACTGGGTTCTATGGTGCCTTTTC -3'

Sequencing Primer
(F):5'- gttcaaatcccagcaaccac -3'
(R):5'- GGTGCCTTTTCATACATATACTGAC -3'
Posted On2014-04-24