Incidental Mutation 'R1614:Vmn2r27'
ID176993
Institutional Source Beutler Lab
Gene Symbol Vmn2r27
Ensembl Gene ENSMUSG00000072778
Gene Namevomeronasal 2, receptor27
SynonymsEG232367
MMRRC Submission 039651-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R1614 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location124191596-124231784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 124223934 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 355 (I355L)
Ref Sequence ENSEMBL: ENSMUSP00000098528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100968]
Predicted Effect probably benign
Transcript: ENSMUST00000100968
AA Change: I355L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000098528
Gene: ENSMUSG00000072778
AA Change: I355L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 81 475 1.1e-27 PFAM
Pfam:NCD3G 519 570 1.3e-18 PFAM
Pfam:7tm_3 603 838 2.6e-50 PFAM
Meta Mutation Damage Score 0.1292 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik T G 11: 85,172,864 S28A possibly damaging Het
Arl9 A G 5: 77,010,565 T165A probably benign Het
Atpaf1 A T 4: 115,796,757 K201N possibly damaging Het
Cacna1b G T 2: 24,690,807 Q676K possibly damaging Het
Ccdc88c A T 12: 100,912,984 H1959Q probably benign Het
Cep162 T C 9: 87,212,932 D808G probably damaging Het
Chtf18 A G 17: 25,727,090 L42P probably benign Het
Cox7c A G 13: 86,045,785 F40L probably benign Het
Dock7 C T 4: 99,061,280 V442I probably benign Het
Dst T C 1: 34,275,263 F4198S probably damaging Het
Fam13a T A 6: 58,940,184 D569V probably damaging Het
Gm6741 T A 17: 91,236,996 H62Q probably benign Het
Gnptab A G 10: 88,414,589 T172A probably benign Het
Greb1 A G 12: 16,701,171 S1013P probably damaging Het
Insl5 A T 4: 103,026,649 L25* probably null Het
Ipo13 A G 4: 117,904,618 S462P probably benign Het
Itgb1 G A 8: 128,720,065 C401Y probably damaging Het
Kcnh7 G T 2: 62,850,604 A213E probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Nabp1 T C 1: 51,471,352 N164D possibly damaging Het
Nop53 A G 7: 15,945,965 V30A probably benign Het
Olfr1246 T A 2: 89,590,696 I140L possibly damaging Het
Olfr1278 T A 2: 111,293,066 V266E probably damaging Het
Olfr1318 T A 2: 112,156,517 C189S probably damaging Het
Olfr346 T G 2: 36,688,309 Y102* probably null Het
Pcsk5 G A 19: 17,515,256 R918C probably damaging Het
Pecam1 T C 11: 106,681,079 D554G probably benign Het
Polr2a T C 11: 69,743,373 I744V possibly damaging Het
Pop1 C A 15: 34,530,210 A918D possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prmt3 A T 7: 49,826,719 I359F possibly damaging Het
Proz G A 8: 13,066,904 C152Y probably damaging Het
Ptgfr A C 3: 151,801,779 Y316D probably benign Het
Ralgapa2 G T 2: 146,388,612 S1011Y probably damaging Het
Rnf43 C T 11: 87,731,659 R529* probably null Het
Slc17a6 G A 7: 51,646,277 probably benign Het
Slc25a19 A T 11: 115,616,623 C224* probably null Het
Smarcd3 A G 5: 24,594,876 S299P possibly damaging Het
Stard9 T C 2: 120,697,675 F1471S possibly damaging Het
Strada A C 11: 106,168,319 V211G probably damaging Het
Tom1l1 T C 11: 90,683,254 E68G probably damaging Het
Vmn2r68 A T 7: 85,221,738 M779K possibly damaging Het
Zbtb18 T C 1: 177,447,170 L23P probably damaging Het
Zfp112 G T 7: 24,126,599 C664F probably damaging Het
Zfp955a A T 17: 33,242,332 N275K possibly damaging Het
Other mutations in Vmn2r27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Vmn2r27 APN 6 124192411 missense possibly damaging 0.86
IGL01388:Vmn2r27 APN 6 124223832 missense possibly damaging 0.55
IGL01923:Vmn2r27 APN 6 124200525 missense probably benign 0.20
IGL01954:Vmn2r27 APN 6 124192248 missense probably damaging 1.00
IGL02105:Vmn2r27 APN 6 124197349 splice site probably benign
IGL02586:Vmn2r27 APN 6 124224475 nonsense probably null
IGL03130:Vmn2r27 APN 6 124192317 missense possibly damaging 0.82
IGL03330:Vmn2r27 APN 6 124230180 nonsense probably null
R0124:Vmn2r27 UTSW 6 124231619 missense probably benign
R0234:Vmn2r27 UTSW 6 124231619 missense probably benign
R0234:Vmn2r27 UTSW 6 124231619 missense probably benign
R0384:Vmn2r27 UTSW 6 124223912 missense probably benign 0.01
R0582:Vmn2r27 UTSW 6 124224290 missense probably benign 0.02
R0733:Vmn2r27 UTSW 6 124192188 missense probably benign 0.18
R0738:Vmn2r27 UTSW 6 124223702 missense possibly damaging 0.48
R0835:Vmn2r27 UTSW 6 124200624 missense probably damaging 0.99
R1183:Vmn2r27 UTSW 6 124200532 missense probably benign
R1401:Vmn2r27 UTSW 6 124191632 nonsense probably null
R1484:Vmn2r27 UTSW 6 124200515 missense probably damaging 0.96
R1536:Vmn2r27 UTSW 6 124200690 missense probably damaging 1.00
R1539:Vmn2r27 UTSW 6 124191771 missense probably damaging 1.00
R1565:Vmn2r27 UTSW 6 124231634 missense probably benign
R1595:Vmn2r27 UTSW 6 124231615 missense probably benign 0.00
R1742:Vmn2r27 UTSW 6 124200677 missense possibly damaging 0.48
R1816:Vmn2r27 UTSW 6 124230371 nonsense probably null
R1822:Vmn2r27 UTSW 6 124231634 missense probably benign
R1824:Vmn2r27 UTSW 6 124231634 missense probably benign
R1870:Vmn2r27 UTSW 6 124224211 missense probably benign 0.11
R1942:Vmn2r27 UTSW 6 124223763 missense probably damaging 1.00
R1962:Vmn2r27 UTSW 6 124223834 missense possibly damaging 0.70
R2069:Vmn2r27 UTSW 6 124224483 missense probably damaging 1.00
R2075:Vmn2r27 UTSW 6 124200551 missense possibly damaging 0.85
R2379:Vmn2r27 UTSW 6 124224383 missense possibly damaging 0.89
R3748:Vmn2r27 UTSW 6 124230392 missense probably benign 0.35
R4384:Vmn2r27 UTSW 6 124224156 missense probably benign 0.05
R4392:Vmn2r27 UTSW 6 124230176 missense probably benign 0.01
R4758:Vmn2r27 UTSW 6 124231637 missense possibly damaging 0.87
R5018:Vmn2r27 UTSW 6 124224182 missense probably benign 0.02
R5235:Vmn2r27 UTSW 6 124192054 missense probably damaging 0.99
R5718:Vmn2r27 UTSW 6 124192144 missense possibly damaging 0.66
R5859:Vmn2r27 UTSW 6 124200688 missense probably damaging 1.00
R5958:Vmn2r27 UTSW 6 124231727 missense probably benign 0.00
R6044:Vmn2r27 UTSW 6 124231772 missense probably benign
R6086:Vmn2r27 UTSW 6 124191999 missense probably damaging 1.00
R6396:Vmn2r27 UTSW 6 124224166 nonsense probably null
R6546:Vmn2r27 UTSW 6 124192410 missense possibly damaging 0.49
R6746:Vmn2r27 UTSW 6 124200593 missense possibly damaging 0.47
R6976:Vmn2r27 UTSW 6 124224353 nonsense probably null
R7091:Vmn2r27 UTSW 6 124223945 missense possibly damaging 0.85
R7145:Vmn2r27 UTSW 6 124191752 missense probably benign
R7176:Vmn2r27 UTSW 6 124192036 missense probably benign 0.01
R7382:Vmn2r27 UTSW 6 124197317 missense probably damaging 1.00
R7482:Vmn2r27 UTSW 6 124224261 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCAGCATGGACTTTGTAGCTC -3'
(R):5'- AGACATGACCAAGCACGGACTTTG -3'

Sequencing Primer
(F):5'- GCTCATAGGTGAGGTATTCATATCCC -3'
(R):5'- GACCAAGCACGGACTTTGTATTG -3'
Posted On2014-04-24