Mutagenetix > Incidental Mutations

Incidental Mutation 'R1614:Slc17a6'

176997

Institutional Source

Beutler Lab

Gene Symbol

Slc17a6

Ensembl Gene

ENSMUSG00000030500

Gene Name

solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6

Synonyms

2900073D12Rik, VGLUT2

MMRRC Submission

039651-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1614 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

51622006-51671119 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

G to A at 51646277 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000146364 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032710] [ENSMUST00000207945]

Predicted Effect

probably benign
Transcript: ENSMUST00000032710

SMART Domains

Protein: ENSMUSP00000032710
Gene: ENSMUSG00000030500

Domain	Start	End	E-Value	Type
Pfam:MFS_1	76	461	6.5e-50	PFAM
transmembrane domain	476	498	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207375

Predicted Effect

probably benign
Transcript: ENSMUST00000207945

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208597

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.4%
20x: 89.4%

Validation Efficiency

100% (53/53)

MGI Phenotype

PHENOTYPE: Mice homozygous for null mutations display neonatal lethality, respiratory failure, and abnormal nervous system physiology. Heterozygous mice for one allele display abnormal miniature EPSC and reduced responses to neuropathic pain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700125H20Rik	T	G	11: 85,172,864	S28A	possibly damaging	Het
Arl9	A	G	5: 77,010,565	T165A	probably benign	Het
Atpaf1	A	T	4: 115,796,757	K201N	possibly damaging	Het
Cacna1b	G	T	2: 24,690,807	Q676K	possibly damaging	Het
Ccdc88c	A	T	12: 100,912,984	H1959Q	probably benign	Het
Cep162	T	C	9: 87,212,932	D808G	probably damaging	Het
Chtf18	A	G	17: 25,727,090	L42P	probably benign	Het
Cox7c	A	G	13: 86,045,785	F40L	probably benign	Het
Dock7	C	T	4: 99,061,280	V442I	probably benign	Het
Dst	T	C	1: 34,275,263	F4198S	probably damaging	Het
Fam13a	T	A	6: 58,940,184	D569V	probably damaging	Het
Gm6741	T	A	17: 91,236,996	H62Q	probably benign	Het
Gnptab	A	G	10: 88,414,589	T172A	probably benign	Het
Greb1	A	G	12: 16,701,171	S1013P	probably damaging	Het
Insl5	A	T	4: 103,026,649	L25*	probably null	Het
Ipo13	A	G	4: 117,904,618	S462P	probably benign	Het
Itgb1	G	A	8: 128,720,065	C401Y	probably damaging	Het
Kcnh7	G	T	2: 62,850,604	A213E	probably benign	Het
Kcnv1	G	A	15: 45,114,444	T66M	probably damaging	Het
Mesp2	T	C	7: 79,811,619	S231P	probably benign	Het
Nabp1	T	C	1: 51,471,352	N164D	possibly damaging	Het
Nop53	A	G	7: 15,945,965	V30A	probably benign	Het
Olfr1246	T	A	2: 89,590,696	I140L	possibly damaging	Het
Olfr1278	T	A	2: 111,293,066	V266E	probably damaging	Het
Olfr1318	T	A	2: 112,156,517	C189S	probably damaging	Het
Olfr346	T	G	2: 36,688,309	Y102*	probably null	Het
Pcsk5	G	A	19: 17,515,256	R918C	probably damaging	Het
Pecam1	T	C	11: 106,681,079	D554G	probably benign	Het
Polr2a	T	C	11: 69,743,373	I744V	possibly damaging	Het
Pop1	C	A	15: 34,530,210	A918D	possibly damaging	Het
Ppp2r5e	C	G	12: 75,469,567	A239P	probably damaging	Het
Prmt3	A	T	7: 49,826,719	I359F	possibly damaging	Het
Proz	G	A	8: 13,066,904	C152Y	probably damaging	Het
Ptgfr	A	C	3: 151,801,779	Y316D	probably benign	Het
Ralgapa2	G	T	2: 146,388,612	S1011Y	probably damaging	Het
Rnf43	C	T	11: 87,731,659	R529*	probably null	Het
Slc25a19	A	T	11: 115,616,623	C224*	probably null	Het
Smarcd3	A	G	5: 24,594,876	S299P	possibly damaging	Het
Stard9	T	C	2: 120,697,675	F1471S	possibly damaging	Het
Strada	A	C	11: 106,168,319	V211G	probably damaging	Het
Tom1l1	T	C	11: 90,683,254	E68G	probably damaging	Het
Vmn2r27	T	G	6: 124,223,934	I355L	probably benign	Het
Vmn2r68	A	T	7: 85,221,738	M779K	possibly damaging	Het
Zbtb18	T	C	1: 177,447,170	L23P	probably damaging	Het
Zfp112	G	T	7: 24,126,599	C664F	probably damaging	Het
Zfp955a	A	T	17: 33,242,332	N275K	possibly damaging	Het

Other mutations in Slc17a6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01408:Slc17a6	APN	7	51669115	missense	probably benign	0.15
IGL01653:Slc17a6	APN	7	51668022	missense	possibly damaging	0.92
IGL01993:Slc17a6	APN	7	51667957	missense	possibly damaging	0.51
IGL02082:Slc17a6	APN	7	51669029	missense	probably benign	0.00
IGL02212:Slc17a6	APN	7	51667470	missense	possibly damaging	0.94
IGL02544:Slc17a6	APN	7	51666155	nonsense	probably null
IGL02585:Slc17a6	APN	7	51625349	missense	probably benign	0.00
IGL03206:Slc17a6	APN	7	51666023	splice site	probably benign
IGL03396:Slc17a6	APN	7	51669092	missense	probably damaging	1.00
R0137:Slc17a6	UTSW	7	51666144	missense	probably benign	0.00
R0141:Slc17a6	UTSW	7	51669067	missense	probably benign	0.10
R0207:Slc17a6	UTSW	7	51646180	intron	probably benign
R0362:Slc17a6	UTSW	7	51658771	missense	probably damaging	1.00
R0841:Slc17a6	UTSW	7	51625315	missense	probably benign	0.29
R1037:Slc17a6	UTSW	7	51649248	splice site	probably benign
R1325:Slc17a6	UTSW	7	51661552	missense	probably benign	0.15
R1625:Slc17a6	UTSW	7	51661460	missense	probably benign	0.00
R1736:Slc17a6	UTSW	7	51661585	splice site	probably benign
R1777:Slc17a6	UTSW	7	51646209	missense	possibly damaging	0.63
R1824:Slc17a6	UTSW	7	51661546	missense	probably damaging	1.00
R2249:Slc17a6	UTSW	7	51667906	missense	probably damaging	1.00
R4283:Slc17a6	UTSW	7	51645076	missense	probably damaging	1.00
R4910:Slc17a6	UTSW	7	51658741	missense	possibly damaging	0.78
R5301:Slc17a6	UTSW	7	51658771	missense	probably damaging	1.00
R5523:Slc17a6	UTSW	7	51626850	nonsense	probably null
R5570:Slc17a6	UTSW	7	51658756	missense	probably benign	0.00
R5720:Slc17a6	UTSW	7	51625397	missense	probably damaging	1.00
R5736:Slc17a6	UTSW	7	51645093	missense	possibly damaging	0.78
R5765:Slc17a6	UTSW	7	51625501	missense	possibly damaging	0.93
R6380:Slc17a6	UTSW	7	51667463	missense	probably benign	0.02
R6989:Slc17a6	UTSW	7	51661476	missense	possibly damaging	0.88
R7178:Slc17a6	UTSW	7	51667511	missense	possibly damaging	0.58
R7194:Slc17a6	UTSW	7	51626892	missense	probably damaging	1.00
R7325:Slc17a6	UTSW	7	51645018	missense	probably damaging	0.96
R7766:Slc17a6	UTSW	7	51669166	missense	probably benign	0.06
R7877:Slc17a6	UTSW	7	51625505	missense	probably benign	0.00
R7898:Slc17a6	UTSW	7	51658825	splice site	probably null
R8059:Slc17a6	UTSW	7	51645044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCAGTAGATTAGAAACGGGCTC -3'
(R):5'- GCAGAGGCAGGAATATCTCTGTG -3'

Sequencing Primer
(F):5'- GGAGGGGATGTGCTAACTTC -3'
(R):5'- GTGATTTCTAGGCCAGCCTG -3'

Posted On

2014-04-24