Incidental Mutation 'R1614:Mesp2'
ID176998
Institutional Source Beutler Lab
Gene Symbol Mesp2
Ensembl Gene ENSMUSG00000030543
Gene Namemesoderm posterior 2
SynonymsbHLHc6
MMRRC Submission 039651-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1614 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location79810727-79813439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79811619 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 231 (S231P)
Ref Sequence ENSEMBL: ENSMUSP00000103017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107394]
Predicted Effect probably benign
Transcript: ENSMUST00000107394
AA Change: S231P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000103017
Gene: ENSMUSG00000030543
AA Change: S231P

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 57 77 N/A INTRINSIC
HLH 85 139 2.16e-10 SMART
internal_repeat_1 161 203 8.79e-6 PROSPERO
internal_repeat_1 219 255 8.79e-6 PROSPERO
low complexity region 282 312 N/A INTRINSIC
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the bHLH family of transcription factors and plays a key role in defining the rostrocaudal patterning of somites via interactions with multiple Notch signaling pathways. This gene is expressed in the anterior presomitic mesoderm and is downregulated immediately after the formation of segmented somites. This gene also plays a role in the formation of epithelial somitic mesoderm and cardiac mesoderm. Mutations in the MESP2 gene cause autosomal recessive spondylocostal dystosis 2 (SCD02). [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit absence of segmented somites, fused vertebral columns and dorsal root ganglia, and impaired sclerotomal polarity. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik T G 11: 85,172,864 S28A possibly damaging Het
Arl9 A G 5: 77,010,565 T165A probably benign Het
Atpaf1 A T 4: 115,796,757 K201N possibly damaging Het
Cacna1b G T 2: 24,690,807 Q676K possibly damaging Het
Ccdc88c A T 12: 100,912,984 H1959Q probably benign Het
Cep162 T C 9: 87,212,932 D808G probably damaging Het
Chtf18 A G 17: 25,727,090 L42P probably benign Het
Cox7c A G 13: 86,045,785 F40L probably benign Het
Dock7 C T 4: 99,061,280 V442I probably benign Het
Dst T C 1: 34,275,263 F4198S probably damaging Het
Fam13a T A 6: 58,940,184 D569V probably damaging Het
Gm6741 T A 17: 91,236,996 H62Q probably benign Het
Gnptab A G 10: 88,414,589 T172A probably benign Het
Greb1 A G 12: 16,701,171 S1013P probably damaging Het
Insl5 A T 4: 103,026,649 L25* probably null Het
Ipo13 A G 4: 117,904,618 S462P probably benign Het
Itgb1 G A 8: 128,720,065 C401Y probably damaging Het
Kcnh7 G T 2: 62,850,604 A213E probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Nabp1 T C 1: 51,471,352 N164D possibly damaging Het
Nop53 A G 7: 15,945,965 V30A probably benign Het
Olfr1246 T A 2: 89,590,696 I140L possibly damaging Het
Olfr1278 T A 2: 111,293,066 V266E probably damaging Het
Olfr1318 T A 2: 112,156,517 C189S probably damaging Het
Olfr346 T G 2: 36,688,309 Y102* probably null Het
Pcsk5 G A 19: 17,515,256 R918C probably damaging Het
Pecam1 T C 11: 106,681,079 D554G probably benign Het
Polr2a T C 11: 69,743,373 I744V possibly damaging Het
Pop1 C A 15: 34,530,210 A918D possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prmt3 A T 7: 49,826,719 I359F possibly damaging Het
Proz G A 8: 13,066,904 C152Y probably damaging Het
Ptgfr A C 3: 151,801,779 Y316D probably benign Het
Ralgapa2 G T 2: 146,388,612 S1011Y probably damaging Het
Rnf43 C T 11: 87,731,659 R529* probably null Het
Slc17a6 G A 7: 51,646,277 probably benign Het
Slc25a19 A T 11: 115,616,623 C224* probably null Het
Smarcd3 A G 5: 24,594,876 S299P possibly damaging Het
Stard9 T C 2: 120,697,675 F1471S possibly damaging Het
Strada A C 11: 106,168,319 V211G probably damaging Het
Tom1l1 T C 11: 90,683,254 E68G probably damaging Het
Vmn2r27 T G 6: 124,223,934 I355L probably benign Het
Vmn2r68 A T 7: 85,221,738 M779K possibly damaging Het
Zbtb18 T C 1: 177,447,170 L23P probably damaging Het
Zfp112 G T 7: 24,126,599 C664F probably damaging Het
Zfp955a A T 17: 33,242,332 N275K possibly damaging Het
Other mutations in Mesp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Mesp2 APN 7 79812653 missense probably benign
IGL02672:Mesp2 APN 7 79811397 missense probably benign 0.01
IGL02707:Mesp2 APN 7 79811526 missense probably benign 0.29
R1581:Mesp2 UTSW 7 79812541 missense possibly damaging 0.48
R3716:Mesp2 UTSW 7 79812794 missense possibly damaging 0.96
R5131:Mesp2 UTSW 7 79811727 missense possibly damaging 0.83
R5221:Mesp2 UTSW 7 79811719 missense possibly damaging 0.84
R5551:Mesp2 UTSW 7 79811619 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGCCTGGGATCAGCCATGAGTAG -3'
(R):5'- TCCCTTCATTGGATAACCTGGGACC -3'

Sequencing Primer
(F):5'- TCAGCCATGAGTAGTGGGG -3'
(R):5'- GAGAGACCGTCCACTTTAGTTC -3'
Posted On2014-04-24