Mutagenetix > Incidental Mutation

Incidental Mutation 'R1614:Vmn2r68'

176999

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r68

Ensembl Gene

ENSMUSG00000096861

Gene Name

vomeronasal 2, receptor 68

Synonyms

Vmn2r68-ps, EG620697

MMRRC Submission

039651-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R1614 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85221518-85237704 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 85221738 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 779 (M779K)

Ref Sequence

ENSEMBL: ENSMUSP00000129411 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061074]

AlphaFold

L7N2B3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000061074
AA Change: M779K

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861
AA Change: M779K

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	77	463	4.5e-28	PFAM
Pfam:NCD3G	507	559	1.1e-18	PFAM
Pfam:7tm_3	589	827	3.7e-53	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.4%
20x: 89.4%

Validation Efficiency

100% (53/53)

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700125H20Rik	T	G	11: 85,172,864	S28A	possibly damaging	Het
Arl9	A	G	5: 77,010,565	T165A	probably benign	Het
Atpaf1	A	T	4: 115,796,757	K201N	possibly damaging	Het
Cacna1b	G	T	2: 24,690,807	Q676K	possibly damaging	Het
Ccdc88c	A	T	12: 100,912,984	H1959Q	probably benign	Het
Cep162	T	C	9: 87,212,932	D808G	probably damaging	Het
Chtf18	A	G	17: 25,727,090	L42P	probably benign	Het
Cox7c	A	G	13: 86,045,785	F40L	probably benign	Het
Dock7	C	T	4: 99,061,280	V442I	probably benign	Het
Dst	T	C	1: 34,275,263	F4198S	probably damaging	Het
Fam13a	T	A	6: 58,940,184	D569V	probably damaging	Het
Gm6741	T	A	17: 91,236,996	H62Q	probably benign	Het
Gnptab	A	G	10: 88,414,589	T172A	probably benign	Het
Greb1	A	G	12: 16,701,171	S1013P	probably damaging	Het
Insl5	A	T	4: 103,026,649	L25*	probably null	Het
Ipo13	A	G	4: 117,904,618	S462P	probably benign	Het
Itgb1	G	A	8: 128,720,065	C401Y	probably damaging	Het
Kcnh7	G	T	2: 62,850,604	A213E	probably benign	Het
Kcnv1	G	A	15: 45,114,444	T66M	probably damaging	Het
Mesp2	T	C	7: 79,811,619	S231P	probably benign	Het
Nabp1	T	C	1: 51,471,352	N164D	possibly damaging	Het
Nop53	A	G	7: 15,945,965	V30A	probably benign	Het
Olfr1246	T	A	2: 89,590,696	I140L	possibly damaging	Het
Olfr1278	T	A	2: 111,293,066	V266E	probably damaging	Het
Olfr1318	T	A	2: 112,156,517	C189S	probably damaging	Het
Olfr346	T	G	2: 36,688,309	Y102*	probably null	Het
Pcsk5	G	A	19: 17,515,256	R918C	probably damaging	Het
Pecam1	T	C	11: 106,681,079	D554G	probably benign	Het
Polr2a	T	C	11: 69,743,373	I744V	possibly damaging	Het
Pop1	C	A	15: 34,530,210	A918D	possibly damaging	Het
Ppp2r5e	C	G	12: 75,469,567	A239P	probably damaging	Het
Prmt3	A	T	7: 49,826,719	I359F	possibly damaging	Het
Proz	G	A	8: 13,066,904	C152Y	probably damaging	Het
Ptgfr	A	C	3: 151,801,779	Y316D	probably benign	Het
Ralgapa2	G	T	2: 146,388,612	S1011Y	probably damaging	Het
Rnf43	C	T	11: 87,731,659	R529*	probably null	Het
Slc17a6	G	A	7: 51,646,277		probably benign	Het
Slc25a19	A	T	11: 115,616,623	C224*	probably null	Het
Smarcd3	A	G	5: 24,594,876	S299P	possibly damaging	Het
Stard9	T	C	2: 120,697,675	F1471S	possibly damaging	Het
Strada	A	C	11: 106,168,319	V211G	probably damaging	Het
Tom1l1	T	C	11: 90,683,254	E68G	probably damaging	Het
Vmn2r27	T	G	6: 124,223,934	I355L	probably benign	Het
Zbtb18	T	C	1: 177,447,170	L23P	probably damaging	Het
Zfp112	G	T	7: 24,126,599	C664F	probably damaging	Het
Zfp955a	A	T	17: 33,242,332	N275K	possibly damaging	Het

Other mutations in Vmn2r68

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01391:Vmn2r68	APN	7	85237611	missense	probably benign
IGL01477:Vmn2r68	APN	7	85233483	missense	probably damaging	1.00
IGL01600:Vmn2r68	APN	7	85222260	missense	probably benign	0.39
IGL01979:Vmn2r68	APN	7	85222117	missense	probably benign
IGL01999:Vmn2r68	APN	7	85222231	missense	probably damaging	1.00
IGL02269:Vmn2r68	APN	7	85221739	missense	possibly damaging	0.84
IGL02517:Vmn2r68	APN	7	85221945	nonsense	probably null
IGL02827:Vmn2r68	APN	7	85237592	missense	probably damaging	1.00
IGL02852:Vmn2r68	APN	7	85233387	missense	probably damaging	1.00
IGL02982:Vmn2r68	APN	7	85234441	missense	probably benign	0.12
IGL03099:Vmn2r68	APN	7	85222240	nonsense	probably null
IGL03166:Vmn2r68	APN	7	85222123	missense	probably benign	0.01
IGL03168:Vmn2r68	APN	7	85221764	missense	probably damaging	1.00
IGL03243:Vmn2r68	APN	7	85233755	missense	possibly damaging	0.66
F5770:Vmn2r68	UTSW	7	85221880	missense	probably benign	0.01
R0280:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0280:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0281:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0281:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0348:Vmn2r68	UTSW	7	85221676	missense	possibly damaging	0.50
R0390:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0390:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0722:Vmn2r68	UTSW	7	85221586	missense	possibly damaging	0.95
R1129:Vmn2r68	UTSW	7	85237504	splice site	probably null
R1136:Vmn2r68	UTSW	7	85222341	missense	possibly damaging	0.81
R1319:Vmn2r68	UTSW	7	85232492	missense	probably damaging	0.96
R1682:Vmn2r68	UTSW	7	85233366	missense	possibly damaging	0.68
R1837:Vmn2r68	UTSW	7	85233678	missense	probably damaging	0.96
R1893:Vmn2r68	UTSW	7	85234659	nonsense	probably null
R1908:Vmn2r68	UTSW	7	85234052	missense	probably benign	0.09
R1909:Vmn2r68	UTSW	7	85234052	missense	probably benign	0.09
R1951:Vmn2r68	UTSW	7	85233894	missense	probably damaging	1.00
R2177:Vmn2r68	UTSW	7	85221915	missense	probably benign	0.01
R2178:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R2185:Vmn2r68	UTSW	7	85233693	nonsense	probably null
R2188:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R2282:Vmn2r68	UTSW	7	85221651	missense	possibly damaging	0.65
R2567:Vmn2r68	UTSW	7	85234595	missense	probably benign
R2869:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2869:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2873:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2874:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R3149:Vmn2r68	UTSW	7	85237667	missense	probably benign	0.00
R3401:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R3978:Vmn2r68	UTSW	7	85232462	missense	probably benign	0.00
R4399:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4401:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4421:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4478:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4479:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4495:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4628:Vmn2r68	UTSW	7	85234465	missense	probably benign	0.00
R4649:Vmn2r68	UTSW	7	85221535	missense	probably benign
R4654:Vmn2r68	UTSW	7	85233561	nonsense	probably null
R4793:Vmn2r68	UTSW	7	85234440	missense	probably benign	0.01
R5007:Vmn2r68	UTSW	7	85232414	missense	probably benign
R5021:Vmn2r68	UTSW	7	85233734	missense	possibly damaging	0.62
R5082:Vmn2r68	UTSW	7	85233868	missense	probably benign	0.12
R5177:Vmn2r68	UTSW	7	85221991	missense	probably damaging	0.99
R5221:Vmn2r68	UTSW	7	85221877	missense	probably damaging	1.00
R5514:Vmn2r68	UTSW	7	85237559	missense	possibly damaging	0.92
R5521:Vmn2r68	UTSW	7	85233718	missense	probably benign	0.03
R5563:Vmn2r68	UTSW	7	85222075	missense	probably damaging	1.00
R5664:Vmn2r68	UTSW	7	85233770	missense	probably benign	0.02
R5829:Vmn2r68	UTSW	7	85237604	missense	probably benign	0.00
R6016:Vmn2r68	UTSW	7	85222245	missense	probably damaging	0.99
R6356:Vmn2r68	UTSW	7	85233840	missense	possibly damaging	0.85
R6413:Vmn2r68	UTSW	7	85221765	missense	probably damaging	1.00
R6418:Vmn2r68	UTSW	7	85233707	missense	probably benign
R6699:Vmn2r68	UTSW	7	85232375	missense	possibly damaging	0.58
R7287:Vmn2r68	UTSW	7	85222252	missense	probably benign	0.33
R7319:Vmn2r68	UTSW	7	85233834	missense	probably benign
R7374:Vmn2r68	UTSW	7	85232399	missense	possibly damaging	0.66
R7585:Vmn2r68	UTSW	7	85232379	missense	probably damaging	1.00
R7605:Vmn2r68	UTSW	7	85233908	missense	probably benign	0.01
R7892:Vmn2r68	UTSW	7	85234514	missense	probably benign
R7979:Vmn2r68	UTSW	7	85234417	critical splice donor site	probably null
R8177:Vmn2r68	UTSW	7	85222214	nonsense	probably null
R8349:Vmn2r68	UTSW	7	85233577	missense	probably damaging	1.00
R8378:Vmn2r68	UTSW	7	85221900	missense	probably benign	0.00
R8397:Vmn2r68	UTSW	7	85237514	missense	possibly damaging	0.71
R8449:Vmn2r68	UTSW	7	85233577	missense	probably damaging	1.00
R8543:Vmn2r68	UTSW	7	85234440	missense	probably benign	0.01
R8680:Vmn2r68	UTSW	7	85222113	missense	possibly damaging	0.68
R9056:Vmn2r68	UTSW	7	85222212	missense	possibly damaging	0.71
R9342:Vmn2r68	UTSW	7	85233785	missense	probably benign	0.39
R9734:Vmn2r68	UTSW	7	85233549	missense	possibly damaging	0.54
V7581:Vmn2r68	UTSW	7	85221880	missense	probably benign	0.01
Z1176:Vmn2r68	UTSW	7	85221733	missense	probably damaging	1.00
Z1176:Vmn2r68	UTSW	7	85222081	missense	probably benign	0.27
Z1176:Vmn2r68	UTSW	7	85222099	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- GGAGTAGAAGCAGCTTTGTAAAAGTGTAGAT -3'
(R):5'- AGCATTCAAAATAACCATTCCAGGAAGAAGA -3'

Sequencing Primer
(F):5'- GCATGTGGTTTCCTGAACTTTTG -3'
(R):5'- TGATGCTGATGCACACATGG -3'

Posted On

2014-04-24