Incidental Mutation 'R1614:Pecam1'
Institutional Source Beutler Lab
Gene Symbol Pecam1
Ensembl Gene ENSMUSG00000020717
Gene Nameplatelet/endothelial cell adhesion molecule 1
SynonymsCd31, PECAM-1
MMRRC Submission 039651-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R1614 (G1)
Quality Score225
Status Validated
Chromosomal Location106654217-106750628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106681079 bp
Amino Acid Change Aspartic acid to Glycine at position 554 (D554G)
Ref Sequence ENSEMBL: ENSMUSP00000138959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068021] [ENSMUST00000080853] [ENSMUST00000103069] [ENSMUST00000106796] [ENSMUST00000183610]
Predicted Effect probably benign
Transcript: ENSMUST00000068021
AA Change: D655G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000067111
Gene: ENSMUSG00000020717
AA Change: D655G

signal peptide 1 17 N/A INTRINSIC
IG 32 118 3.54e-4 SMART
Pfam:Ig_3 122 198 4.2e-4 PFAM
IG_like 230 311 1.38e2 SMART
IG_like 327 382 2e-1 SMART
Blast:IG_like 405 486 3e-31 BLAST
IG 497 584 5.49e-1 SMART
transmembrane domain 592 614 N/A INTRINSIC
PDB:2KY5|A 676 718 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000080853
AA Change: D655G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000079664
Gene: ENSMUSG00000020717
AA Change: D655G

signal peptide 1 17 N/A INTRINSIC
IG 32 118 3.54e-4 SMART
IG_like 230 311 1.38e2 SMART
IG_like 327 382 2e-1 SMART
Blast:IG_like 405 486 3e-31 BLAST
IG 497 584 5.49e-1 SMART
transmembrane domain 592 614 N/A INTRINSIC
PDB:2KY5|A 676 710 4e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000103069
AA Change: D655G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099358
Gene: ENSMUSG00000020717
AA Change: D655G

signal peptide 1 17 N/A INTRINSIC
IG 32 118 3.54e-4 SMART
IG_like 230 311 1.38e2 SMART
IG_like 327 382 2e-1 SMART
Blast:IG_like 405 486 3e-31 BLAST
IG 497 584 5.49e-1 SMART
transmembrane domain 592 614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106796
AA Change: D655G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102408
Gene: ENSMUSG00000020717
AA Change: D655G

signal peptide 1 17 N/A INTRINSIC
IG 32 118 3.54e-4 SMART
IG_like 230 311 1.38e2 SMART
IG_like 327 382 2e-1 SMART
Blast:IG_like 405 486 3e-31 BLAST
IG 497 584 5.49e-1 SMART
transmembrane domain 592 614 N/A INTRINSIC
PDB:2KY5|A 676 727 1e-16 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000183610
AA Change: D554G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138959
Gene: ENSMUSG00000020717
AA Change: D554G

signal peptide 1 17 N/A INTRINSIC
IG 32 118 3.54e-4 SMART
IG_like 129 210 1.38e2 SMART
IG_like 226 281 2e-1 SMART
Blast:IG_like 304 385 2e-31 BLAST
IG 396 483 5.49e-1 SMART
transmembrane domain 491 513 N/A INTRINSIC
PDB:2KY5|A 575 626 1e-16 PDB
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found on the surface of platelets, monocytes, neutrophils, and some types of T-cells, and makes up a large portion of endothelial cell intercellular junctions. The encoded protein is a member of the immunoglobulin superfamily and is likely involved in leukocyte migration, angiogenesis, and integrin activation. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show increased susceptibility to collagen-induced arthritis, impaired lung alveolarization, and enhanced susceptibility to endotoxic shock. Mice homozygous for a gene-trapped allele show altered vasodilation and nitric oxide homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik T G 11: 85,172,864 S28A possibly damaging Het
Arl9 A G 5: 77,010,565 T165A probably benign Het
Atpaf1 A T 4: 115,796,757 K201N possibly damaging Het
Cacna1b G T 2: 24,690,807 Q676K possibly damaging Het
Ccdc88c A T 12: 100,912,984 H1959Q probably benign Het
Cep162 T C 9: 87,212,932 D808G probably damaging Het
Chtf18 A G 17: 25,727,090 L42P probably benign Het
Cox7c A G 13: 86,045,785 F40L probably benign Het
Dock7 C T 4: 99,061,280 V442I probably benign Het
Dst T C 1: 34,275,263 F4198S probably damaging Het
Fam13a T A 6: 58,940,184 D569V probably damaging Het
Gm6741 T A 17: 91,236,996 H62Q probably benign Het
Gnptab A G 10: 88,414,589 T172A probably benign Het
Greb1 A G 12: 16,701,171 S1013P probably damaging Het
Insl5 A T 4: 103,026,649 L25* probably null Het
Ipo13 A G 4: 117,904,618 S462P probably benign Het
Itgb1 G A 8: 128,720,065 C401Y probably damaging Het
Kcnh7 G T 2: 62,850,604 A213E probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Nabp1 T C 1: 51,471,352 N164D possibly damaging Het
Nop53 A G 7: 15,945,965 V30A probably benign Het
Olfr1246 T A 2: 89,590,696 I140L possibly damaging Het
Olfr1278 T A 2: 111,293,066 V266E probably damaging Het
Olfr1318 T A 2: 112,156,517 C189S probably damaging Het
Olfr346 T G 2: 36,688,309 Y102* probably null Het
Pcsk5 G A 19: 17,515,256 R918C probably damaging Het
Polr2a T C 11: 69,743,373 I744V possibly damaging Het
Pop1 C A 15: 34,530,210 A918D possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prmt3 A T 7: 49,826,719 I359F possibly damaging Het
Proz G A 8: 13,066,904 C152Y probably damaging Het
Ptgfr A C 3: 151,801,779 Y316D probably benign Het
Ralgapa2 G T 2: 146,388,612 S1011Y probably damaging Het
Rnf43 C T 11: 87,731,659 R529* probably null Het
Slc17a6 G A 7: 51,646,277 probably benign Het
Slc25a19 A T 11: 115,616,623 C224* probably null Het
Smarcd3 A G 5: 24,594,876 S299P possibly damaging Het
Stard9 T C 2: 120,697,675 F1471S possibly damaging Het
Strada A C 11: 106,168,319 V211G probably damaging Het
Tom1l1 T C 11: 90,683,254 E68G probably damaging Het
Vmn2r27 T G 6: 124,223,934 I355L probably benign Het
Vmn2r68 A T 7: 85,221,738 M779K possibly damaging Het
Zbtb18 T C 1: 177,447,170 L23P probably damaging Het
Zfp112 G T 7: 24,126,599 C664F probably damaging Het
Zfp955a A T 17: 33,242,332 N275K possibly damaging Het
Other mutations in Pecam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Pecam1 APN 11 106699798 missense probably damaging 1.00
IGL01914:Pecam1 APN 11 106699867 missense possibly damaging 0.95
IGL02035:Pecam1 APN 11 106695859 missense probably benign 0.43
IGL02124:Pecam1 APN 11 106690981 missense probably damaging 0.98
IGL02487:Pecam1 APN 11 106671780 missense probably damaging 1.00
IGL02576:Pecam1 APN 11 106671774 missense probably damaging 1.00
IGL03101:Pecam1 APN 11 106697351 missense probably damaging 0.99
R1495:Pecam1 UTSW 11 106688856 missense probably damaging 0.96
R1628:Pecam1 UTSW 11 106682960 splice site probably null
R1950:Pecam1 UTSW 11 106685203 missense probably damaging 1.00
R1994:Pecam1 UTSW 11 106695937 missense possibly damaging 0.95
R3149:Pecam1 UTSW 11 106684281 missense possibly damaging 0.53
R4022:Pecam1 UTSW 11 106655160 missense probably benign 0.00
R4418:Pecam1 UTSW 11 106695922 missense possibly damaging 0.61
R4747:Pecam1 UTSW 11 106684246 missense probably benign 0.29
R4828:Pecam1 UTSW 11 106699808 missense probably damaging 1.00
R5798:Pecam1 UTSW 11 106695832 missense possibly damaging 0.95
R5864:Pecam1 UTSW 11 106684250 nonsense probably null
R5942:Pecam1 UTSW 11 106661983 intron probably benign
R5966:Pecam1 UTSW 11 106691061 missense probably benign 0.44
R6285:Pecam1 UTSW 11 106685239 missense probably benign 0.02
R6519:Pecam1 UTSW 11 106699642 missense probably benign 0.01
R7078:Pecam1 UTSW 11 106688947 missense probably benign 0.06
R7135:Pecam1 UTSW 11 106689031 missense probably damaging 0.99
R7215:Pecam1 UTSW 11 106695919 missense probably benign 0.15
R7574:Pecam1 UTSW 11 106699784 missense probably damaging 1.00
R7795:Pecam1 UTSW 11 106695832 nonsense probably null
R7855:Pecam1 UTSW 11 106671750 missense probably benign 0.00
R8296:Pecam1 UTSW 11 106688919 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ctagaactctctatgtccgcc -3'
Posted On2014-04-24