Incidental Mutation 'R1614:Ppp2r5e'
ID177013
Institutional Source Beutler Lab
Gene Symbol Ppp2r5e
Ensembl Gene ENSMUSG00000021051
Gene Nameprotein phosphatase 2, regulatory subunit B', epsilon
SynonymsB56beta, protein phosphatase 2A subunit beta, 4633401M22Rik
MMRRC Submission 039651-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1614 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location75450881-75596245 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 75469567 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Proline at position 239 (A239P)
Ref Sequence ENSEMBL: ENSMUSP00000021447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021447] [ENSMUST00000218012] [ENSMUST00000220035]
Predicted Effect probably damaging
Transcript: ENSMUST00000021447
AA Change: A239P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021447
Gene: ENSMUSG00000021051
AA Change: A239P

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
Pfam:B56 48 453 3.2e-195 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218012
Predicted Effect probably damaging
Transcript: ENSMUST00000220035
AA Change: A205P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.6233 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes an epsilon isoform of the regulatory subunit B56 subfamily. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik T G 11: 85,172,864 S28A possibly damaging Het
Arl9 A G 5: 77,010,565 T165A probably benign Het
Atpaf1 A T 4: 115,796,757 K201N possibly damaging Het
Cacna1b G T 2: 24,690,807 Q676K possibly damaging Het
Ccdc88c A T 12: 100,912,984 H1959Q probably benign Het
Cep162 T C 9: 87,212,932 D808G probably damaging Het
Chtf18 A G 17: 25,727,090 L42P probably benign Het
Cox7c A G 13: 86,045,785 F40L probably benign Het
Dock7 C T 4: 99,061,280 V442I probably benign Het
Dst T C 1: 34,275,263 F4198S probably damaging Het
Fam13a T A 6: 58,940,184 D569V probably damaging Het
Gm6741 T A 17: 91,236,996 H62Q probably benign Het
Gnptab A G 10: 88,414,589 T172A probably benign Het
Greb1 A G 12: 16,701,171 S1013P probably damaging Het
Insl5 A T 4: 103,026,649 L25* probably null Het
Ipo13 A G 4: 117,904,618 S462P probably benign Het
Itgb1 G A 8: 128,720,065 C401Y probably damaging Het
Kcnh7 G T 2: 62,850,604 A213E probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Nabp1 T C 1: 51,471,352 N164D possibly damaging Het
Nop53 A G 7: 15,945,965 V30A probably benign Het
Olfr1246 T A 2: 89,590,696 I140L possibly damaging Het
Olfr1278 T A 2: 111,293,066 V266E probably damaging Het
Olfr1318 T A 2: 112,156,517 C189S probably damaging Het
Olfr346 T G 2: 36,688,309 Y102* probably null Het
Pcsk5 G A 19: 17,515,256 R918C probably damaging Het
Pecam1 T C 11: 106,681,079 D554G probably benign Het
Polr2a T C 11: 69,743,373 I744V possibly damaging Het
Pop1 C A 15: 34,530,210 A918D possibly damaging Het
Prmt3 A T 7: 49,826,719 I359F possibly damaging Het
Proz G A 8: 13,066,904 C152Y probably damaging Het
Ptgfr A C 3: 151,801,779 Y316D probably benign Het
Ralgapa2 G T 2: 146,388,612 S1011Y probably damaging Het
Rnf43 C T 11: 87,731,659 R529* probably null Het
Slc17a6 G A 7: 51,646,277 probably benign Het
Slc25a19 A T 11: 115,616,623 C224* probably null Het
Smarcd3 A G 5: 24,594,876 S299P possibly damaging Het
Stard9 T C 2: 120,697,675 F1471S possibly damaging Het
Strada A C 11: 106,168,319 V211G probably damaging Het
Tom1l1 T C 11: 90,683,254 E68G probably damaging Het
Vmn2r27 T G 6: 124,223,934 I355L probably benign Het
Vmn2r68 A T 7: 85,221,738 M779K possibly damaging Het
Zbtb18 T C 1: 177,447,170 L23P probably damaging Het
Zfp112 G T 7: 24,126,599 C664F probably damaging Het
Zfp955a A T 17: 33,242,332 N275K possibly damaging Het
Other mutations in Ppp2r5e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02602:Ppp2r5e APN 12 75493439 missense probably damaging 1.00
IGL03398:Ppp2r5e APN 12 75462405 missense possibly damaging 0.73
IGL03402:Ppp2r5e APN 12 75464893 missense probably damaging 0.99
R0129:Ppp2r5e UTSW 12 75462390 missense probably damaging 1.00
R0466:Ppp2r5e UTSW 12 75462442 splice site probably benign
R0894:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1452:Ppp2r5e UTSW 12 75469536 splice site probably benign
R1551:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1693:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1844:Ppp2r5e UTSW 12 75469766 missense possibly damaging 0.81
R1864:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1908:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1909:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1933:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R2181:Ppp2r5e UTSW 12 75462324 missense probably benign 0.08
R3084:Ppp2r5e UTSW 12 75468616 missense probably benign 0.23
R4212:Ppp2r5e UTSW 12 75469551 missense probably damaging 1.00
R4213:Ppp2r5e UTSW 12 75469551 missense probably damaging 1.00
R4680:Ppp2r5e UTSW 12 75469759 missense probably damaging 1.00
R4761:Ppp2r5e UTSW 12 75593261 missense possibly damaging 0.92
R5147:Ppp2r5e UTSW 12 75469770 missense probably damaging 0.96
R5262:Ppp2r5e UTSW 12 75593271 missense probably damaging 1.00
R5304:Ppp2r5e UTSW 12 75515685 missense possibly damaging 0.75
R5429:Ppp2r5e UTSW 12 75453763 missense probably damaging 0.99
R5439:Ppp2r5e UTSW 12 75493476 missense probably benign
R7225:Ppp2r5e UTSW 12 75468579 missense probably damaging 0.96
R7453:Ppp2r5e UTSW 12 75462342 missense probably damaging 0.99
R7558:Ppp2r5e UTSW 12 75464992 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTTGAGAGTCACTTGGGAAACAG -3'
(R):5'- TTGCCTAAAAGTGTCTCTAACCGCC -3'

Sequencing Primer
(F):5'- TCACTTGGGAAACAGGCTAAGC -3'
(R):5'- TTTGACAGTGAAGACCCTCG -3'
Posted On2014-04-24