Incidental Mutation 'R1615:Prkag2'
Institutional Source Beutler Lab
Gene Symbol Prkag2
Ensembl Gene ENSMUSG00000028944
Gene Nameprotein kinase, AMP-activated, gamma 2 non-catalytic subunit
MMRRC Submission 039652-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1615 (G1)
Quality Score225
Status Validated
Chromosomal Location24862744-25100642 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24875178 bp
Amino Acid Change Asparagine to Lysine at position 120 (N120K)
Ref Sequence ENSEMBL: ENSMUSP00000110626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030784] [ENSMUST00000076306] [ENSMUST00000114975] [ENSMUST00000131486] [ENSMUST00000150135]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030784
AA Change: N360K

PolyPhen 2 Score 0.557 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030784
Gene: ENSMUSG00000028944
AA Change: N360K

low complexity region 9 29 N/A INTRINSIC
low complexity region 81 95 N/A INTRINSIC
low complexity region 113 122 N/A INTRINSIC
low complexity region 129 144 N/A INTRINSIC
low complexity region 151 172 N/A INTRINSIC
low complexity region 228 243 N/A INTRINSIC
CBS 276 325 7.01e-6 SMART
CBS 357 406 4.28e-10 SMART
CBS 432 480 8.11e-11 SMART
CBS 504 552 3.62e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076306
AA Change: N237K

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000075651
Gene: ENSMUSG00000028944
AA Change: N237K

low complexity region 33 46 N/A INTRINSIC
low complexity region 104 119 N/A INTRINSIC
CBS 153 202 7.01e-6 SMART
CBS 234 283 4.28e-10 SMART
CBS 309 357 8.11e-11 SMART
CBS 381 429 3.62e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114975
AA Change: N120K

PolyPhen 2 Score 0.557 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110626
Gene: ENSMUSG00000028944
AA Change: N120K

CBS 36 85 7.01e-6 SMART
CBS 117 166 4.28e-10 SMART
CBS 192 240 8.11e-11 SMART
CBS 264 312 3.62e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129022
Predicted Effect probably benign
Transcript: ENSMUST00000131486
AA Change: N102K

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000115760
Gene: ENSMUSG00000028944
AA Change: N102K

CBS 18 67 7.01e-6 SMART
CBS 99 148 4.28e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139698
Predicted Effect probably benign
Transcript: ENSMUST00000150135
AA Change: N121K

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114978
Gene: ENSMUSG00000028944
AA Change: N121K

CBS 37 86 7.01e-6 SMART
CBS 118 167 4.28e-10 SMART
CBS 193 241 8.11e-11 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] AMP-activated protein kinase (AMPK) is a heterotrimeric protein composed of a catalytic alpha subunit, a noncatalytic beta subunit, and a noncatalytic regulatory gamma subunit. Various forms of each of these subunits exist, encoded by different genes. AMPK is an important energy-sensing enzyme that monitors cellular energy status and functions by inactivating key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This gene is a member of the AMPK gamma subunit family. Mutations in this gene have been associated with Wolff-Parkinson-White syndrome, familial hypertrophic cardiomyopathy, and glycogen storage disease of the heart. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygous constitutively active mutants develop age related obesity caused by polyphagia, glucose intolerance and insulin resistance and exhibit slowing of heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik C T 9: 58,499,068 A87V probably damaging Het
Adcy8 A T 15: 64,871,776 C328S probably benign Het
Adgrv1 G T 13: 81,424,288 T4918K probably benign Het
Aen T C 7: 78,905,912 Y108H probably damaging Het
Amer3 T C 1: 34,588,171 M497T probably damaging Het
Arid2 C T 15: 96,371,654 T1216M possibly damaging Het
Birc6 A G 17: 74,609,409 probably null Het
Bzw2 A G 12: 36,119,127 probably benign Het
Ccr1 T C 9: 123,963,536 H319R probably benign Het
Dnah11 A G 12: 118,050,722 I2010T probably damaging Het
Dnhd1 A G 7: 105,703,206 Y2522C probably benign Het
Dnhd1 T A 7: 105,713,706 I3825K possibly damaging Het
Dst A T 1: 34,199,371 D3718V probably damaging Het
Esp36 A G 17: 38,419,439 probably benign Het
Fbxw21 T C 9: 109,143,726 Y380C probably damaging Het
Fhad1 G A 4: 141,922,323 T836M probably damaging Het
Fhod1 C T 8: 105,347,831 probably benign Het
Flt1 A G 5: 147,639,288 C637R probably damaging Het
Fmnl2 A G 2: 53,118,424 K809E probably damaging Het
Grm1 G T 10: 10,741,508 Y510* probably null Het
Hey1 A T 3: 8,664,838 H186Q possibly damaging Het
Itga2b C T 11: 102,460,137 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Lmcd1 A G 6: 112,273,950 D7G probably benign Het
Lrrc1 T C 9: 77,435,118 D358G possibly damaging Het
Lyn A G 4: 3,748,765 K248E probably benign Het
Map4k4 A G 1: 40,006,830 probably benign Het
Map4k5 A T 12: 69,844,413 L160H probably damaging Het
Myo6 C T 9: 80,307,725 R1247C probably damaging Het
Myo9a A G 9: 59,788,456 E347G possibly damaging Het
Ndfip1 C T 18: 38,460,619 P213S probably benign Het
Neurl3 T C 1: 36,269,389 E114G possibly damaging Het
Nlrp14 A T 7: 107,196,163 I877F probably benign Het
Obscn A G 11: 59,099,825 S1733P probably benign Het
Oxgr1 A T 14: 120,022,773 S7R probably benign Het
Plcb1 A T 2: 135,362,444 probably benign Het
Rnf43 C T 11: 87,731,659 R529* probably null Het
Saraf A G 8: 34,165,288 K174E possibly damaging Het
Scrib T C 15: 76,066,205 Q264R probably benign Het
Sh3rf3 T A 10: 59,131,077 M747K probably benign Het
Shf T C 2: 122,349,432 H421R probably damaging Het
Slc35g3 A G 11: 69,760,542 S228P probably damaging Het
Slit1 A G 19: 41,650,671 probably benign Het
Soga1 T G 2: 157,020,743 H1422P probably damaging Het
Srrm4 A G 5: 116,447,300 probably benign Het
Stfa1 T G 16: 36,280,467 V23G probably damaging Het
Swap70 A G 7: 110,273,291 D371G probably benign Het
Tada2a T C 11: 84,103,100 D186G probably damaging Het
Tdpoz3 C A 3: 93,826,311 Q98K probably benign Het
Tgfbrap1 A G 1: 43,051,985 V660A probably benign Het
Tnn A G 1: 160,118,408 Y947H possibly damaging Het
Trim60 A T 8: 65,000,510 C362* probably null Het
Vmn1r81 T A 7: 12,260,514 N56Y probably damaging Het
Vsig8 A G 1: 172,559,713 D52G probably damaging Het
Wdfy4 G A 14: 33,042,512 R2140C probably damaging Het
Other mutations in Prkag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Prkag2 APN 5 25021965 missense probably benign 0.01
R0437:Prkag2 UTSW 5 25028505 missense possibly damaging 0.65
R0622:Prkag2 UTSW 5 24869249 missense probably damaging 0.98
R0755:Prkag2 UTSW 5 24947631 missense probably benign 0.25
R1400:Prkag2 UTSW 5 24873918 missense probably damaging 1.00
R1561:Prkag2 UTSW 5 24871595 missense probably damaging 1.00
R1569:Prkag2 UTSW 5 24947477 missense possibly damaging 0.59
R1612:Prkag2 UTSW 5 24877028 missense probably benign 0.06
R1700:Prkag2 UTSW 5 24871541 missense probably damaging 0.97
R2011:Prkag2 UTSW 5 24871054 critical splice donor site probably null
R2045:Prkag2 UTSW 5 24947582 missense possibly damaging 0.76
R2230:Prkag2 UTSW 5 24908364 missense probably benign 0.10
R2863:Prkag2 UTSW 5 25021792 missense probably benign 0.39
R3104:Prkag2 UTSW 5 24871069 nonsense probably null
R4193:Prkag2 UTSW 5 24878760 missense probably damaging 1.00
R4520:Prkag2 UTSW 5 24866171 missense probably damaging 1.00
R4604:Prkag2 UTSW 5 24878734 missense probably damaging 1.00
R5736:Prkag2 UTSW 5 24878722 missense probably damaging 1.00
R6273:Prkag2 UTSW 5 24947536 missense probably damaging 0.96
R6414:Prkag2 UTSW 5 25100180 start gained probably benign
R6510:Prkag2 UTSW 5 25100288 start gained probably benign
R6511:Prkag2 UTSW 5 25100288 start gained probably benign
R7035:Prkag2 UTSW 5 24947566 missense probably damaging 1.00
R7084:Prkag2 UTSW 5 25021969 missense probably benign
R7211:Prkag2 UTSW 5 24995298 missense probably benign 0.00
R7353:Prkag2 UTSW 5 24880686 missense possibly damaging 0.85
R8204:Prkag2 UTSW 5 24869127 splice site probably null
R8354:Prkag2 UTSW 5 24869139 nonsense probably null
R8401:Prkag2 UTSW 5 24863870 missense probably benign
R8560:Prkag2 UTSW 5 24866065 critical splice donor site probably benign
R8747:Prkag2 UTSW 5 24880682 critical splice donor site probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gcaatcctcttatgtcagccttc -3'
Posted On2014-04-24