Incidental Mutation 'R1569:Lcmt2'
ID177093
Institutional Source Beutler Lab
Gene Symbol Lcmt2
Ensembl Gene ENSMUSG00000074890
Gene Nameleucine carboxyl methyltransferase 2
Synonyms
MMRRC Submission 039608-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R1569 (G1)
Quality Score182
Status Validated
Chromosome2
Chromosomal Location121128307-121140653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121139828 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 258 (F258S)
Ref Sequence ENSEMBL: ENSMUSP00000106302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028702] [ENSMUST00000066155] [ENSMUST00000099486] [ENSMUST00000110662] [ENSMUST00000110665] [ENSMUST00000110674] [ENSMUST00000119031]
Predicted Effect probably benign
Transcript: ENSMUST00000028702
SMART Domains Protein: ENSMUSP00000028702
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 1 276 1.8e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066155
SMART Domains Protein: ENSMUSP00000067133
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 16 343 1.6e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099486
AA Change: F38S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097085
Gene: ENSMUSG00000074890
AA Change: F38S

DomainStartEndE-ValueType
PDB:3P71|T 4 94 6e-12 PDB
SCOP:d1k3ia3 137 401 2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110662
SMART Domains Protein: ENSMUSP00000106290
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 2 200 1.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110665
SMART Domains Protein: ENSMUSP00000106293
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 2 236 4.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110674
AA Change: F258S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106302
Gene: ENSMUSG00000074890
AA Change: F258S

DomainStartEndE-ValueType
Pfam:LCM 12 207 5.4e-28 PFAM
Pfam:Kelch_3 492 542 2.2e-6 PFAM
low complexity region 544 563 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119031
SMART Domains Protein: ENSMUSP00000113052
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 16 343 3e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158384
Meta Mutation Damage Score 0.7188 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this intronless gene belongs to the highly variable methyltransferase superfamily. This gene is the inferred homolog of the Saccharomyces cerevisiae carboxymethyltransferase gene PPM2 that is essential for the synthesis of the hypermodified guanosine Wybutosine (yW). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,797 K166* probably null Het
Abca2 T A 2: 25,439,185 N1012K probably benign Het
Ahnak T C 19: 9,004,094 V914A possibly damaging Het
Akap1 T A 11: 88,833,180 M833L probably benign Het
Atp2b1 T A 10: 98,987,326 H249Q probably benign Het
Atp6v0a4 A G 6: 38,050,625 V750A probably damaging Het
Car6 T C 4: 150,201,042 Y23C probably damaging Het
Celsr3 A G 9: 108,829,068 T917A probably damaging Het
Clmn C A 12: 104,781,081 D736Y probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dennd4c G A 4: 86,786,094 R282H possibly damaging Het
Dsg1b T A 18: 20,396,480 N327K probably damaging Het
Eftud2 A T 11: 102,854,771 probably benign Het
Esyt1 G T 10: 128,518,994 S512R possibly damaging Het
Fam124b T C 1: 80,213,135 Y177C possibly damaging Het
Fbxl5 A T 5: 43,765,461 I205K probably damaging Het
Fcrl1 A G 3: 87,384,705 Y57C probably damaging Het
Gabpb1 A T 2: 126,652,251 D151E probably benign Het
Gcc2 C T 10: 58,270,171 L310F probably benign Het
Hsd11b1 C G 1: 193,240,327 E141Q probably damaging Het
Htr1b A G 9: 81,632,287 V89A probably benign Het
Ibsp A T 5: 104,310,151 T185S probably damaging Het
Igfn1 T C 1: 135,969,033 D1265G probably benign Het
Ints9 T C 14: 64,980,122 Y33H possibly damaging Het
Kif1a A T 1: 93,058,810 probably benign Het
Lama1 A T 17: 67,780,618 probably null Het
Lbp A T 2: 158,319,687 D223V probably damaging Het
Lck C A 4: 129,555,656 D283Y probably damaging Het
Lsg1 G T 16: 30,581,005 probably null Het
Maip1 T C 1: 57,413,395 probably benign Het
Mark3 T G 12: 111,633,746 I465S probably benign Het
Marveld2 C T 13: 100,600,998 V128I probably benign Het
Mcm3ap A G 10: 76,483,188 H750R possibly damaging Het
Mdn1 A T 4: 32,723,501 Q2479L probably null Het
Met A T 6: 17,531,504 K594* probably null Het
Pak2 G T 16: 32,037,295 S241R probably damaging Het
Plxna4 T C 6: 32,185,475 I1368V possibly damaging Het
Pparg T C 6: 115,439,999 I51T probably benign Het
Ppp1r18 A G 17: 35,868,703 E62G probably damaging Het
Prkag2 T C 5: 24,947,477 S86G possibly damaging Het
Rabgap1l A T 1: 160,702,390 I347K probably benign Het
Rdh1 A T 10: 127,763,072 M141L probably benign Het
Rfx2 A T 17: 56,804,326 I82N possibly damaging Het
Sh2b2 G A 5: 136,231,735 A209V possibly damaging Het
Sh3d19 G A 3: 86,126,644 R768H possibly damaging Het
Sh3rf1 C T 8: 61,384,862 P814S probably damaging Het
Shbg T A 11: 69,617,589 probably benign Het
Slc15a2 T C 16: 36,756,383 T430A probably benign Het
Slc17a3 A T 13: 23,855,608 I250F probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spg11 A G 2: 122,101,706 S552P probably damaging Het
Srpk2 A G 5: 23,514,026 I597T probably damaging Het
St6galnac1 T G 11: 116,769,271 N72T possibly damaging Het
Tecpr2 T A 12: 110,944,887 probably null Het
Tmem208 T A 8: 105,334,830 C163S possibly damaging Het
Tpte T C 8: 22,345,031 V401A probably damaging Het
Trhde A G 10: 114,446,188 W795R possibly damaging Het
Trpm3 G A 19: 22,889,445 probably null Het
Ttn T A 2: 76,795,719 T14999S possibly damaging Het
Txndc2 A T 17: 65,638,926 N85K probably benign Het
Yes1 A G 5: 32,653,163 Y192C probably damaging Het
Zan A G 5: 137,429,130 V2415A unknown Het
Zfp410 T A 12: 84,332,952 C311S probably damaging Het
Zfp51 A T 17: 21,456,380 M38L probably benign Het
Zfp560 A T 9: 20,348,715 C284S possibly damaging Het
Zfp808 C T 13: 62,172,900 R648* probably null Het
Zfp976 G T 7: 42,613,382 H344N probably damaging Het
Other mutations in Lcmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:Lcmt2 APN 2 121138913 missense possibly damaging 0.94
R0352:Lcmt2 UTSW 2 121138896 missense probably benign 0.06
R0519:Lcmt2 UTSW 2 121139344 unclassified probably null
R0685:Lcmt2 UTSW 2 121139240 missense probably benign 0.14
R1437:Lcmt2 UTSW 2 121138896 missense probably benign 0.06
R1500:Lcmt2 UTSW 2 121140007 missense probably benign 0.00
R1612:Lcmt2 UTSW 2 121139120 missense probably damaging 1.00
R1618:Lcmt2 UTSW 2 121138652 missense probably damaging 0.98
R1990:Lcmt2 UTSW 2 121140281 missense probably benign 0.07
R2091:Lcmt2 UTSW 2 121138616 missense probably damaging 1.00
R2159:Lcmt2 UTSW 2 121139285 missense probably damaging 1.00
R3812:Lcmt2 UTSW 2 121138706 missense probably benign 0.01
R4725:Lcmt2 UTSW 2 121139430 missense probably benign 0.00
R4727:Lcmt2 UTSW 2 121139430 missense probably benign 0.00
R4968:Lcmt2 UTSW 2 121139736 missense probably benign 0.00
R5626:Lcmt2 UTSW 2 121139462 missense probably benign
R6246:Lcmt2 UTSW 2 121140389 missense probably damaging 1.00
R6326:Lcmt2 UTSW 2 121139457 nonsense probably null
R6524:Lcmt2 UTSW 2 121138931 missense possibly damaging 0.75
R6924:Lcmt2 UTSW 2 121140003 missense probably benign
R7282:Lcmt2 UTSW 2 121138790 missense probably damaging 1.00
R7405:Lcmt2 UTSW 2 121139387 missense probably benign 0.07
R7408:Lcmt2 UTSW 2 121138704 missense probably benign 0.08
R8062:Lcmt2 UTSW 2 121140272 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AAAGAAGCCTCTGAGGGCTCAAAC -3'
(R):5'- TTTCAAGATCGGGGACTCGGCG -3'

Sequencing Primer
(F):5'- GCTCAAACACTGGAGTTTCTGAC -3'
(R):5'- TGCTGACCTACTTGGAGCC -3'
Posted On2014-04-24