Incidental Mutation 'R1569:Lck'
ID177103
Institutional Source Beutler Lab
Gene Symbol Lck
Ensembl Gene ENSMUSG00000000409
Gene Namelymphocyte protein tyrosine kinase
SynonymsHck-3, p56
MMRRC Submission 039608-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1569 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location129548344-129573641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 129555656 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 283 (D283Y)
Ref Sequence ENSEMBL: ENSMUSP00000099656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067240] [ENSMUST00000102596] [ENSMUST00000134336] [ENSMUST00000167288]
Predicted Effect probably damaging
Transcript: ENSMUST00000067240
AA Change: D283Y

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066209
Gene: ENSMUSG00000000409
AA Change: D283Y

DomainStartEndE-ValueType
SH3 64 120 3.53e-17 SMART
SH2 125 215 2.07e-34 SMART
TyrKc 245 494 2.66e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102596
AA Change: D283Y

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099656
Gene: ENSMUSG00000000409
AA Change: D283Y

DomainStartEndE-ValueType
SH3 64 120 3.53e-17 SMART
SH2 125 215 2.07e-34 SMART
TyrKc 245 494 2.66e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132030
Predicted Effect probably benign
Transcript: ENSMUST00000134336
SMART Domains Protein: ENSMUSP00000119263
Gene: ENSMUSG00000000409

DomainStartEndE-ValueType
PDB:1Q69|B 7 33 9e-12 PDB
SCOP:d1awj__ 45 92 2e-8 SMART
PDB:1LCK|A 53 92 3e-20 PDB
Blast:SH3 64 92 4e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139957
Predicted Effect possibly damaging
Transcript: ENSMUST00000167288
AA Change: D294Y

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125777
Gene: ENSMUSG00000000409
AA Change: D294Y

DomainStartEndE-ValueType
SH3 75 131 3.53e-17 SMART
SH2 136 226 2.07e-34 SMART
TyrKc 256 505 2.66e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183371
Meta Mutation Damage Score 0.6142 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein is a key signaling molecule in the selection and maturation of developing T-cells. It contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to the plasma membrane and pericentrosomal vesicles, and binds to cell surface receptors, including CD4 and CD8, and other signaling molecules. Multiple alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit thymic atrophy with reduced numbers of peripheral T cells. Null mutants have few double positive and no mature single positive (SP) thymocytes. A hypomorph has decreased expression of CD3epsilon chain onSP thymocytes, whose numbers are reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,797 K166* probably null Het
Abca2 T A 2: 25,439,185 N1012K probably benign Het
Ahnak T C 19: 9,004,094 V914A possibly damaging Het
Akap1 T A 11: 88,833,180 M833L probably benign Het
Atp2b1 T A 10: 98,987,326 H249Q probably benign Het
Atp6v0a4 A G 6: 38,050,625 V750A probably damaging Het
Car6 T C 4: 150,201,042 Y23C probably damaging Het
Celsr3 A G 9: 108,829,068 T917A probably damaging Het
Clmn C A 12: 104,781,081 D736Y probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dennd4c G A 4: 86,786,094 R282H possibly damaging Het
Dsg1b T A 18: 20,396,480 N327K probably damaging Het
Eftud2 A T 11: 102,854,771 probably benign Het
Esyt1 G T 10: 128,518,994 S512R possibly damaging Het
Fam124b T C 1: 80,213,135 Y177C possibly damaging Het
Fbxl5 A T 5: 43,765,461 I205K probably damaging Het
Fcrl1 A G 3: 87,384,705 Y57C probably damaging Het
Gabpb1 A T 2: 126,652,251 D151E probably benign Het
Gcc2 C T 10: 58,270,171 L310F probably benign Het
Hsd11b1 C G 1: 193,240,327 E141Q probably damaging Het
Htr1b A G 9: 81,632,287 V89A probably benign Het
Ibsp A T 5: 104,310,151 T185S probably damaging Het
Igfn1 T C 1: 135,969,033 D1265G probably benign Het
Ints9 T C 14: 64,980,122 Y33H possibly damaging Het
Kif1a A T 1: 93,058,810 probably benign Het
Lama1 A T 17: 67,780,618 probably null Het
Lbp A T 2: 158,319,687 D223V probably damaging Het
Lcmt2 A G 2: 121,139,828 F258S probably damaging Het
Lsg1 G T 16: 30,581,005 probably null Het
Maip1 T C 1: 57,413,395 probably benign Het
Mark3 T G 12: 111,633,746 I465S probably benign Het
Marveld2 C T 13: 100,600,998 V128I probably benign Het
Mcm3ap A G 10: 76,483,188 H750R possibly damaging Het
Mdn1 A T 4: 32,723,501 Q2479L probably null Het
Met A T 6: 17,531,504 K594* probably null Het
Pak2 G T 16: 32,037,295 S241R probably damaging Het
Plxna4 T C 6: 32,185,475 I1368V possibly damaging Het
Pparg T C 6: 115,439,999 I51T probably benign Het
Ppp1r18 A G 17: 35,868,703 E62G probably damaging Het
Prkag2 T C 5: 24,947,477 S86G possibly damaging Het
Rabgap1l A T 1: 160,702,390 I347K probably benign Het
Rdh1 A T 10: 127,763,072 M141L probably benign Het
Rfx2 A T 17: 56,804,326 I82N possibly damaging Het
Sh2b2 G A 5: 136,231,735 A209V possibly damaging Het
Sh3d19 G A 3: 86,126,644 R768H possibly damaging Het
Sh3rf1 C T 8: 61,384,862 P814S probably damaging Het
Shbg T A 11: 69,617,589 probably benign Het
Slc15a2 T C 16: 36,756,383 T430A probably benign Het
Slc17a3 A T 13: 23,855,608 I250F probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spg11 A G 2: 122,101,706 S552P probably damaging Het
Srpk2 A G 5: 23,514,026 I597T probably damaging Het
St6galnac1 T G 11: 116,769,271 N72T possibly damaging Het
Tecpr2 T A 12: 110,944,887 probably null Het
Tmem208 T A 8: 105,334,830 C163S possibly damaging Het
Tpte T C 8: 22,345,031 V401A probably damaging Het
Trhde A G 10: 114,446,188 W795R possibly damaging Het
Trpm3 G A 19: 22,889,445 probably null Het
Ttn T A 2: 76,795,719 T14999S possibly damaging Het
Txndc2 A T 17: 65,638,926 N85K probably benign Het
Yes1 A G 5: 32,653,163 Y192C probably damaging Het
Zan A G 5: 137,429,130 V2415A unknown Het
Zfp410 T A 12: 84,332,952 C311S probably damaging Het
Zfp51 A T 17: 21,456,380 M38L probably benign Het
Zfp560 A T 9: 20,348,715 C284S possibly damaging Het
Zfp808 C T 13: 62,172,900 R648* probably null Het
Zfp976 G T 7: 42,613,382 H344N probably damaging Het
Other mutations in Lck
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01824:Lck APN 4 129558146 missense probably benign 0.00
IGL02666:Lck APN 4 129556419 missense probably damaging 0.98
iconoclast UTSW 4 129555604 missense probably damaging 1.00
lockdown UTSW 4 129558127 missense probably damaging 1.00
stromberg UTSW 4 129555640 missense probably damaging 1.00
swan UTSW 4 129555640 missense probably damaging 1.00
R0091:Lck UTSW 4 129555681 missense possibly damaging 0.88
R0480:Lck UTSW 4 129555640 missense probably damaging 1.00
R1013:Lck UTSW 4 129558127 missense probably damaging 1.00
R1510:Lck UTSW 4 129555668 missense possibly damaging 0.92
R1845:Lck UTSW 4 129558086 missense probably benign 0.00
R2001:Lck UTSW 4 129548937 missense probably benign 0.00
R2141:Lck UTSW 4 129548920 missense probably damaging 1.00
R4694:Lck UTSW 4 129548972 missense possibly damaging 0.66
R4737:Lck UTSW 4 129555984 missense possibly damaging 0.93
R5706:Lck UTSW 4 129551638 critical splice acceptor site probably null
R5712:Lck UTSW 4 129556310 missense probably benign
R7023:Lck UTSW 4 129548865 missense possibly damaging 0.89
R7411:Lck UTSW 4 129551970 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGCATTCTGAAACCCAGGTGGGC -3'
(R):5'- TGACCCTCGGGACTGATTGGAAAG -3'

Sequencing Primer
(F):5'- ACGTTCTTCCAAAGCTTAGGG -3'
(R):5'- CGGGACTGATTGGAAAGAGGAG -3'
Posted On2014-04-24