Mutagenetix > Incidental Mutation

Incidental Mutation 'R1569:Plxna4'

177114

Institutional Source

Beutler Lab

Gene Symbol

Plxna4

Ensembl Gene

ENSMUSG00000029765

Gene Name

plexin A4

Synonyms

Plxa4

MMRRC Submission

039608-MU

Accession Numbers

Genbank: NM_175750

Essential gene?

Possibly non essential (E-score: 0.373) question?

Stock #

R1569 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32144268-32588192 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 32185475 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1368 (I1368V)

Ref Sequence

ENSEMBL: ENSMUSP00000110748 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115096]

AlphaFold

Q80UG2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115096
AA Change: I1368V

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000110748
Gene: ENSMUSG00000029765
AA Change: I1368V

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	50	490	2.3e-131	SMART
PSI	508	558	2.21e-14	SMART
PSI	654	701	2.44e-7	SMART
PSI	802	855	1.2e-6	SMART
IPT	856	950	7.25e-16	SMART
IPT	952	1036	4.1e-15	SMART
IPT	1038	1138	2.86e-14	SMART
IPT	1140	1229	6.88e-1	SMART
transmembrane domain	1237	1259	N/A	INTRINSIC
Pfam:Plexin_cytopl	1310	1863	1.8e-264	PFAM

Meta Mutation Damage Score

0.1894

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.3%

Validation Efficiency

96% (72/75)

MGI Phenotype

PHENOTYPE: Homozygous null mice exhibit defective trajecotory and projection of peripheral sensory axons and sympathetic ganglion axons and the formation of the anterior commissure and the barrels. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	A	9: 124,293,797	K166*	probably null	Het
Abca2	T	A	2: 25,439,185	N1012K	probably benign	Het
Ahnak	T	C	19: 9,004,094	V914A	possibly damaging	Het
Akap1	T	A	11: 88,833,180	M833L	probably benign	Het
Atp2b1	T	A	10: 98,987,326	H249Q	probably benign	Het
Atp6v0a4	A	G	6: 38,050,625	V750A	probably damaging	Het
Car6	T	C	4: 150,201,042	Y23C	probably damaging	Het
Celsr3	A	G	9: 108,829,068	T917A	probably damaging	Het
Clmn	C	A	12: 104,781,081	D736Y	probably damaging	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dennd4c	G	A	4: 86,786,094	R282H	possibly damaging	Het
Dsg1b	T	A	18: 20,396,480	N327K	probably damaging	Het
Eftud2	A	T	11: 102,854,771		probably benign	Het
Esyt1	G	T	10: 128,518,994	S512R	possibly damaging	Het
Fam124b	T	C	1: 80,213,135	Y177C	possibly damaging	Het
Fbxl5	A	T	5: 43,765,461	I205K	probably damaging	Het
Fcrl1	A	G	3: 87,384,705	Y57C	probably damaging	Het
Gabpb1	A	T	2: 126,652,251	D151E	probably benign	Het
Gcc2	C	T	10: 58,270,171	L310F	probably benign	Het
Hsd11b1	C	G	1: 193,240,327	E141Q	probably damaging	Het
Htr1b	A	G	9: 81,632,287	V89A	probably benign	Het
Ibsp	A	T	5: 104,310,151	T185S	probably damaging	Het
Igfn1	T	C	1: 135,969,033	D1265G	probably benign	Het
Ints9	T	C	14: 64,980,122	Y33H	possibly damaging	Het
Kif1a	A	T	1: 93,058,810		probably benign	Het
Lama1	A	T	17: 67,780,618		probably null	Het
Lbp	A	T	2: 158,319,687	D223V	probably damaging	Het
Lck	C	A	4: 129,555,656	D283Y	probably damaging	Het
Lcmt2	A	G	2: 121,139,828	F258S	probably damaging	Het
Lsg1	G	T	16: 30,581,005		probably null	Het
Maip1	T	C	1: 57,413,395		probably benign	Het
Mark3	T	G	12: 111,633,746	I465S	probably benign	Het
Marveld2	C	T	13: 100,600,998	V128I	probably benign	Het
Mcm3ap	A	G	10: 76,483,188	H750R	possibly damaging	Het
Mdn1	A	T	4: 32,723,501	Q2479L	probably null	Het
Met	A	T	6: 17,531,504	K594*	probably null	Het
Pak2	G	T	16: 32,037,295	S241R	probably damaging	Het
Pparg	T	C	6: 115,439,999	I51T	probably benign	Het
Ppp1r18	A	G	17: 35,868,703	E62G	probably damaging	Het
Prkag2	T	C	5: 24,947,477	S86G	possibly damaging	Het
Rabgap1l	A	T	1: 160,702,390	I347K	probably benign	Het
Rdh1	A	T	10: 127,763,072	M141L	probably benign	Het
Rfx2	A	T	17: 56,804,326	I82N	possibly damaging	Het
Sh2b2	G	A	5: 136,231,735	A209V	possibly damaging	Het
Sh3d19	G	A	3: 86,126,644	R768H	possibly damaging	Het
Sh3rf1	C	T	8: 61,384,862	P814S	probably damaging	Het
Shbg	T	A	11: 69,617,589		probably benign	Het
Slc15a2	T	C	16: 36,756,383	T430A	probably benign	Het
Slc17a3	A	T	13: 23,855,608	I250F	probably benign	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Spg11	A	G	2: 122,101,706	S552P	probably damaging	Het
Srpk2	A	G	5: 23,514,026	I597T	probably damaging	Het
St6galnac1	T	G	11: 116,769,271	N72T	possibly damaging	Het
Tecpr2	T	A	12: 110,944,887		probably null	Het
Tmem208	T	A	8: 105,334,830	C163S	possibly damaging	Het
Tpte	T	C	8: 22,345,031	V401A	probably damaging	Het
Trhde	A	G	10: 114,446,188	W795R	possibly damaging	Het
Trpm3	G	A	19: 22,889,445		probably null	Het
Ttn	T	A	2: 76,795,719	T14999S	possibly damaging	Het
Txndc2	A	T	17: 65,638,926	N85K	probably benign	Het
Yes1	A	G	5: 32,653,163	Y192C	probably damaging	Het
Zan	A	G	5: 137,429,130	V2415A	unknown	Het
Zfp410	T	A	12: 84,332,952	C311S	probably damaging	Het
Zfp51	A	T	17: 21,456,380	M38L	probably benign	Het
Zfp560	A	T	9: 20,348,715	C284S	possibly damaging	Het
Zfp808	C	T	13: 62,172,900	R648*	probably null	Het
Zfp976	G	T	7: 42,613,382	H344N	probably damaging	Het

Other mutations in Plxna4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Plxna4	APN	6	32162091	missense	probably damaging	1.00
IGL01395:Plxna4	APN	6	32239433	missense	probably damaging	0.99
IGL01506:Plxna4	APN	6	32516535	missense	probably damaging	1.00
IGL01606:Plxna4	APN	6	32158001	missense	probably damaging	1.00
IGL01753:Plxna4	APN	6	32310478	missense	probably benign	0.06
IGL01767:Plxna4	APN	6	32237678	missense	possibly damaging	0.51
IGL01968:Plxna4	APN	6	32215204	missense	possibly damaging	0.81
IGL02109:Plxna4	APN	6	32215641	missense	probably benign
IGL02299:Plxna4	APN	6	32165156	missense	probably benign	0.01
IGL02306:Plxna4	APN	6	32206124	missense	probably benign	0.19
IGL02312:Plxna4	APN	6	32165117	missense	possibly damaging	0.79
IGL02326:Plxna4	APN	6	32152905	missense	probably damaging	0.99
IGL02658:Plxna4	APN	6	32185411	missense	probably damaging	1.00
IGL02683:Plxna4	APN	6	32517606	missense	probably benign	0.03
IGL02701:Plxna4	APN	6	32517559	missense	probably benign	0.01
IGL02995:Plxna4	APN	6	32516595	missense	probably damaging	1.00
IGL03030:Plxna4	APN	6	32202225	missense	probably benign	0.01
IGL03264:Plxna4	APN	6	32178402	missense	possibly damaging	0.64
IGL03304:Plxna4	APN	6	32165051	splice site	probably benign
IGL03382:Plxna4	APN	6	32202194	missense	probably benign	0.23
corona	UTSW	6	32517264	missense	probably damaging	1.00
Disposed	UTSW	6	32516505	missense	probably damaging	1.00
inclined	UTSW	6	32237723	nonsense	probably null
Slope	UTSW	6	32234606	missense	probably benign	0.00
G4846:Plxna4	UTSW	6	32192272	missense	probably damaging	1.00
R0133:Plxna4	UTSW	6	32197074	missense	probably benign	0.00
R0200:Plxna4	UTSW	6	32197088	missense	probably damaging	0.99
R0308:Plxna4	UTSW	6	32237768	missense	probably benign	0.01
R0468:Plxna4	UTSW	6	32215246	missense	probably damaging	1.00
R0505:Plxna4	UTSW	6	32202119	missense	probably benign
R0542:Plxna4	UTSW	6	32192297	missense	probably damaging	1.00
R0548:Plxna4	UTSW	6	32158015	missense	probably damaging	1.00
R0652:Plxna4	UTSW	6	32185501	missense	probably damaging	1.00
R1144:Plxna4	UTSW	6	32197156	missense	possibly damaging	0.58
R1190:Plxna4	UTSW	6	32251136	missense	probably damaging	1.00
R1228:Plxna4	UTSW	6	32224152	splice site	probably null
R1803:Plxna4	UTSW	6	32517444	missense	probably damaging	0.98
R1832:Plxna4	UTSW	6	32197826	missense	probably benign	0.01
R2068:Plxna4	UTSW	6	32517616	missense	possibly damaging	0.66
R2157:Plxna4	UTSW	6	32516974	missense	probably benign	0.00
R2842:Plxna4	UTSW	6	32215631	critical splice donor site	probably null
R2849:Plxna4	UTSW	6	32185532	missense	probably damaging	1.00
R2892:Plxna4	UTSW	6	32517037	missense	probably damaging	1.00
R2930:Plxna4	UTSW	6	32165780	missense	probably damaging	1.00
R3892:Plxna4	UTSW	6	32215654	missense	probably damaging	1.00
R4065:Plxna4	UTSW	6	32236365	nonsense	probably null
R4276:Plxna4	UTSW	6	32200948	missense	probably benign	0.29
R4307:Plxna4	UTSW	6	32163509	missense	probably damaging	0.99
R4331:Plxna4	UTSW	6	32150545	nonsense	probably null
R4478:Plxna4	UTSW	6	32196133	missense	possibly damaging	0.89
R4529:Plxna4	UTSW	6	32496896	critical splice acceptor site	probably null
R4566:Plxna4	UTSW	6	32517403	missense	probably benign	0.00
R4568:Plxna4	UTSW	6	32152938	missense	probably damaging	1.00
R4664:Plxna4	UTSW	6	32516950	missense	possibly damaging	0.88
R4685:Plxna4	UTSW	6	32165844	missense	probably damaging	1.00
R4701:Plxna4	UTSW	6	32516688	missense	probably damaging	0.99
R4939:Plxna4	UTSW	6	32165762	missense	probably damaging	1.00
R5153:Plxna4	UTSW	6	32224159	splice site	probably null
R5181:Plxna4	UTSW	6	32516997	missense	probably damaging	1.00
R5256:Plxna4	UTSW	6	32251072	missense	probably benign	0.03
R5259:Plxna4	UTSW	6	32517021	missense	possibly damaging	0.89
R5306:Plxna4	UTSW	6	32206121	missense	probably damaging	0.99
R5487:Plxna4	UTSW	6	32517283	missense	probably damaging	1.00
R5510:Plxna4	UTSW	6	32178358	missense	probably damaging	0.96
R5542:Plxna4	UTSW	6	32206230	missense	probably damaging	1.00
R5567:Plxna4	UTSW	6	32157980	missense	possibly damaging	0.61
R5634:Plxna4	UTSW	6	32237723	nonsense	probably null
R5653:Plxna4	UTSW	6	32517616	missense	possibly damaging	0.66
R5665:Plxna4	UTSW	6	32215722	missense	probably damaging	1.00
R5845:Plxna4	UTSW	6	32237776	missense	probably damaging	1.00
R5909:Plxna4	UTSW	6	32517246	missense	probably damaging	1.00
R5938:Plxna4	UTSW	6	32234606	missense	probably benign	0.00
R5973:Plxna4	UTSW	6	32251065	splice site	probably null
R6433:Plxna4	UTSW	6	32215678	missense	probably damaging	0.97
R6482:Plxna4	UTSW	6	32516737	missense	probably benign
R6560:Plxna4	UTSW	6	32215678	missense	probably damaging	0.97
R6721:Plxna4	UTSW	6	32200859	missense	probably benign	0.26
R6810:Plxna4	UTSW	6	32310522	missense	probably benign	0.18
R6985:Plxna4	UTSW	6	32237708	missense	probably damaging	1.00
R7024:Plxna4	UTSW	6	32192269	missense	probably damaging	1.00
R7046:Plxna4	UTSW	6	32516505	missense	probably damaging	1.00
R7137:Plxna4	UTSW	6	32517264	missense	probably damaging	1.00
R7163:Plxna4	UTSW	6	32496756	missense	probably benign	0.01
R7199:Plxna4	UTSW	6	32215178	nonsense	probably null
R7248:Plxna4	UTSW	6	32162160	missense	probably damaging	0.99
R7260:Plxna4	UTSW	6	32239520	missense	possibly damaging	0.79
R7361:Plxna4	UTSW	6	32196122	critical splice donor site	probably null
R7383:Plxna4	UTSW	6	32152799	critical splice donor site	probably null
R7405:Plxna4	UTSW	6	32196319	missense	probably benign	0.00
R7516:Plxna4	UTSW	6	32237768	missense	probably benign	0.00
R7635:Plxna4	UTSW	6	32496741	missense	probably damaging	0.98
R7754:Plxna4	UTSW	6	32152872	missense	probably damaging	1.00
R7763:Plxna4	UTSW	6	32223980	missense	probably damaging	0.99
R7789:Plxna4	UTSW	6	32206233	critical splice acceptor site	probably null
R8167:Plxna4	UTSW	6	32517046	missense	probably damaging	0.99
R8191:Plxna4	UTSW	6	32516950	missense	possibly damaging	0.88
R8225:Plxna4	UTSW	6	32162103	missense	probably damaging	1.00
R8284:Plxna4	UTSW	6	32152854	missense	probably benign	0.25
R8305:Plxna4	UTSW	6	32211065	missense	possibly damaging	0.81
R8438:Plxna4	UTSW	6	32202180	missense	probably damaging	1.00
R8493:Plxna4	UTSW	6	32215712	missense	probably benign	0.27
R8714:Plxna4	UTSW	6	32163444	nonsense	probably null
R8759:Plxna4	UTSW	6	32192341	missense	probably damaging	1.00
R8822:Plxna4	UTSW	6	32150496	missense	possibly damaging	0.89
R8844:Plxna4	UTSW	6	32197091	missense	probably benign	0.11
R8974:Plxna4	UTSW	6	32239512	missense	possibly damaging	0.79
R9020:Plxna4	UTSW	6	32234562	missense	possibly damaging	0.90
R9144:Plxna4	UTSW	6	32185561	missense	possibly damaging	0.77
R9206:Plxna4	UTSW	6	32517444	missense	probably damaging	0.98
R9208:Plxna4	UTSW	6	32517444	missense	probably damaging	0.98
R9257:Plxna4	UTSW	6	32162083	missense	probably damaging	0.99
R9269:Plxna4	UTSW	6	32178380	missense	probably benign	0.00
R9411:Plxna4	UTSW	6	32182747	missense	probably damaging	1.00
R9469:Plxna4	UTSW	6	32517591	missense	probably benign
R9583:Plxna4	UTSW	6	32215234	missense	possibly damaging	0.78
R9647:Plxna4	UTSW	6	32251109	missense	probably damaging	1.00
R9695:Plxna4	UTSW	6	32206121	missense	probably benign	0.02
R9801:Plxna4	UTSW	6	32163591	critical splice acceptor site	probably null
V1024:Plxna4	UTSW	6	32234574	missense	probably damaging	1.00
X0027:Plxna4	UTSW	6	32517044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGCCGTACATTAGGATTGGGCTG -3'
(R):5'- CACAATAGAGGGGCCTGTTCTTCG -3'

Sequencing Primer
(F):5'- TAGGGGATACTCTGACCCCAG -3'
(R):5'- TCGGGCAGTTAGCGAGG -3'

Posted On

2014-04-24