Incidental Mutation 'R1569:Atp6v0a4'
ID177115
Institutional Source Beutler Lab
Gene Symbol Atp6v0a4
Ensembl Gene ENSMUSG00000038600
Gene NameATPase, H+ transporting, lysosomal V0 subunit A4
SynonymsV-ATPase alpha 4, Atp6n1b
MMRRC Submission 039608-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1569 (G1)
Quality Score94
Status Validated
Chromosome6
Chromosomal Location38048483-38124586 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38050625 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 750 (V750A)
Ref Sequence ENSEMBL: ENSMUSP00000110558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040259] [ENSMUST00000096040] [ENSMUST00000114908]
Predicted Effect probably damaging
Transcript: ENSMUST00000040259
AA Change: V750A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039381
Gene: ENSMUSG00000038600
AA Change: V750A

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 824 3.5e-293 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000040486
Predicted Effect probably benign
Transcript: ENSMUST00000096040
SMART Domains Protein: ENSMUSP00000093743
Gene: ENSMUSG00000029830

DomainStartEndE-ValueType
Pfam:Sugar_tr 17 297 5.5e-20 PFAM
Pfam:MFS_1 50 308 2.1e-20 PFAM
transmembrane domain 349 371 N/A INTRINSIC
transmembrane domain 384 406 N/A INTRINSIC
transmembrane domain 459 481 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114908
AA Change: V750A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110558
Gene: ENSMUSG00000038600
AA Change: V750A

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 823 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135594
Meta Mutation Damage Score 0.7334 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular compartments of eukaryotic cells. V-ATPase dependent acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. This gene is one of four genes in man and mouse that encode different isoforms of the a subunit. Alternatively spliced transcript variants encoding the same protein have been described. Mutations in this gene are associated with renal tubular acidosis associated with preserved hearing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display postnatal or premature lethality, hyperchloremic hypokalemic acidosis with hypocitraturia, inner ear defects, impaired hearing, and impaired olfaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,797 K166* probably null Het
Abca2 T A 2: 25,439,185 N1012K probably benign Het
Ahnak T C 19: 9,004,094 V914A possibly damaging Het
Akap1 T A 11: 88,833,180 M833L probably benign Het
Atp2b1 T A 10: 98,987,326 H249Q probably benign Het
Car6 T C 4: 150,201,042 Y23C probably damaging Het
Celsr3 A G 9: 108,829,068 T917A probably damaging Het
Clmn C A 12: 104,781,081 D736Y probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dennd4c G A 4: 86,786,094 R282H possibly damaging Het
Dsg1b T A 18: 20,396,480 N327K probably damaging Het
Eftud2 A T 11: 102,854,771 probably benign Het
Esyt1 G T 10: 128,518,994 S512R possibly damaging Het
Fam124b T C 1: 80,213,135 Y177C possibly damaging Het
Fbxl5 A T 5: 43,765,461 I205K probably damaging Het
Fcrl1 A G 3: 87,384,705 Y57C probably damaging Het
Gabpb1 A T 2: 126,652,251 D151E probably benign Het
Gcc2 C T 10: 58,270,171 L310F probably benign Het
Hsd11b1 C G 1: 193,240,327 E141Q probably damaging Het
Htr1b A G 9: 81,632,287 V89A probably benign Het
Ibsp A T 5: 104,310,151 T185S probably damaging Het
Igfn1 T C 1: 135,969,033 D1265G probably benign Het
Ints9 T C 14: 64,980,122 Y33H possibly damaging Het
Kif1a A T 1: 93,058,810 probably benign Het
Lama1 A T 17: 67,780,618 probably null Het
Lbp A T 2: 158,319,687 D223V probably damaging Het
Lck C A 4: 129,555,656 D283Y probably damaging Het
Lcmt2 A G 2: 121,139,828 F258S probably damaging Het
Lsg1 G T 16: 30,581,005 probably null Het
Maip1 T C 1: 57,413,395 probably benign Het
Mark3 T G 12: 111,633,746 I465S probably benign Het
Marveld2 C T 13: 100,600,998 V128I probably benign Het
Mcm3ap A G 10: 76,483,188 H750R possibly damaging Het
Mdn1 A T 4: 32,723,501 Q2479L probably null Het
Met A T 6: 17,531,504 K594* probably null Het
Pak2 G T 16: 32,037,295 S241R probably damaging Het
Plxna4 T C 6: 32,185,475 I1368V possibly damaging Het
Pparg T C 6: 115,439,999 I51T probably benign Het
Ppp1r18 A G 17: 35,868,703 E62G probably damaging Het
Prkag2 T C 5: 24,947,477 S86G possibly damaging Het
Rabgap1l A T 1: 160,702,390 I347K probably benign Het
Rdh1 A T 10: 127,763,072 M141L probably benign Het
Rfx2 A T 17: 56,804,326 I82N possibly damaging Het
Sh2b2 G A 5: 136,231,735 A209V possibly damaging Het
Sh3d19 G A 3: 86,126,644 R768H possibly damaging Het
Sh3rf1 C T 8: 61,384,862 P814S probably damaging Het
Shbg T A 11: 69,617,589 probably benign Het
Slc15a2 T C 16: 36,756,383 T430A probably benign Het
Slc17a3 A T 13: 23,855,608 I250F probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spg11 A G 2: 122,101,706 S552P probably damaging Het
Srpk2 A G 5: 23,514,026 I597T probably damaging Het
St6galnac1 T G 11: 116,769,271 N72T possibly damaging Het
Tecpr2 T A 12: 110,944,887 probably null Het
Tmem208 T A 8: 105,334,830 C163S possibly damaging Het
Tpte T C 8: 22,345,031 V401A probably damaging Het
Trhde A G 10: 114,446,188 W795R possibly damaging Het
Trpm3 G A 19: 22,889,445 probably null Het
Ttn T A 2: 76,795,719 T14999S possibly damaging Het
Txndc2 A T 17: 65,638,926 N85K probably benign Het
Yes1 A G 5: 32,653,163 Y192C probably damaging Het
Zan A G 5: 137,429,130 V2415A unknown Het
Zfp410 T A 12: 84,332,952 C311S probably damaging Het
Zfp51 A T 17: 21,456,380 M38L probably benign Het
Zfp560 A T 9: 20,348,715 C284S possibly damaging Het
Zfp808 C T 13: 62,172,900 R648* probably null Het
Zfp976 G T 7: 42,613,382 H344N probably damaging Het
Other mutations in Atp6v0a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Atp6v0a4 APN 6 38092790 nonsense probably null
IGL01358:Atp6v0a4 APN 6 38074210 missense probably damaging 1.00
IGL01781:Atp6v0a4 APN 6 38074160 missense possibly damaging 0.91
IGL01934:Atp6v0a4 APN 6 38051546 missense possibly damaging 0.90
IGL01953:Atp6v0a4 APN 6 38054617 missense probably damaging 0.97
IGL03190:Atp6v0a4 APN 6 38054556 missense probably benign 0.02
R0049:Atp6v0a4 UTSW 6 38082081 missense probably damaging 1.00
R0049:Atp6v0a4 UTSW 6 38082081 missense probably damaging 1.00
R0100:Atp6v0a4 UTSW 6 38076815 missense probably benign
R0105:Atp6v0a4 UTSW 6 38053129 splice site probably benign
R1754:Atp6v0a4 UTSW 6 38067829 missense probably benign
R2142:Atp6v0a4 UTSW 6 38082936 nonsense probably null
R2162:Atp6v0a4 UTSW 6 38088646 missense possibly damaging 0.89
R2433:Atp6v0a4 UTSW 6 38082029 critical splice donor site probably null
R2892:Atp6v0a4 UTSW 6 38053017 missense probably benign 0.00
R4599:Atp6v0a4 UTSW 6 38078802 missense probably benign 0.01
R4687:Atp6v0a4 UTSW 6 38092465 missense possibly damaging 0.95
R4716:Atp6v0a4 UTSW 6 38061064 missense probably damaging 1.00
R4938:Atp6v0a4 UTSW 6 38078814 missense possibly damaging 0.80
R5062:Atp6v0a4 UTSW 6 38074183 missense probably benign 0.05
R5437:Atp6v0a4 UTSW 6 38076733 missense probably damaging 0.97
R5440:Atp6v0a4 UTSW 6 38092817 missense probably damaging 0.96
R5697:Atp6v0a4 UTSW 6 38050507 splice site probably null
R5698:Atp6v0a4 UTSW 6 38050507 splice site probably null
R6425:Atp6v0a4 UTSW 6 38050511 missense possibly damaging 0.88
R7659:Atp6v0a4 UTSW 6 38071972 missense probably damaging 1.00
R8004:Atp6v0a4 UTSW 6 38050549 missense possibly damaging 0.93
R8270:Atp6v0a4 UTSW 6 38074229 missense probably damaging 1.00
Z1176:Atp6v0a4 UTSW 6 38049036 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGATCTGCCAACTGACCTGAAGCC -3'
(R):5'- TTCTTGCTGGAAGCTCCACCAC -3'

Sequencing Primer
(F):5'- TTCATGACAGGGCAGCCAG -3'
(R):5'- CAGTGATCAAAGCTGTGGTGC -3'
Posted On2014-04-24