Incidental Mutation 'R1569:Zfp560'
ID177122
Institutional Source Beutler Lab
Gene Symbol Zfp560
Ensembl Gene ENSMUSG00000045519
Gene Namezinc finger protein 560
Synonyms
MMRRC Submission 039608-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1569 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location20345136-20385177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20348715 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 284 (C284S)
Ref Sequence ENSEMBL: ENSMUSP00000065620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068079] [ENSMUST00000143992]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068079
AA Change: C284S

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000065620
Gene: ENSMUSG00000045519
AA Change: C284S

DomainStartEndE-ValueType
KRAB 41 101 3.22e-27 SMART
low complexity region 147 158 N/A INTRINSIC
ZnF_C2H2 279 301 4.01e-5 SMART
ZnF_C2H2 307 329 9.58e-3 SMART
ZnF_C2H2 335 357 5.5e-3 SMART
ZnF_C2H2 363 385 9.58e-3 SMART
ZnF_C2H2 391 413 3.74e-5 SMART
ZnF_C2H2 419 441 2.43e-4 SMART
ZnF_C2H2 447 469 1.28e-3 SMART
ZnF_C2H2 475 497 1.06e-4 SMART
ZnF_C2H2 503 525 3.11e-2 SMART
ZnF_C2H2 531 553 8.47e-4 SMART
ZnF_C2H2 559 581 2.99e-4 SMART
ZnF_C2H2 587 609 4.24e-4 SMART
ZnF_C2H2 615 637 3.44e-4 SMART
ZnF_C2H2 643 665 1.26e-2 SMART
ZnF_C2H2 671 693 1.69e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214965
Meta Mutation Damage Score 0.5104 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency 96% (72/75)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,797 K166* probably null Het
Abca2 T A 2: 25,439,185 N1012K probably benign Het
Ahnak T C 19: 9,004,094 V914A possibly damaging Het
Akap1 T A 11: 88,833,180 M833L probably benign Het
Atp2b1 T A 10: 98,987,326 H249Q probably benign Het
Atp6v0a4 A G 6: 38,050,625 V750A probably damaging Het
Car6 T C 4: 150,201,042 Y23C probably damaging Het
Celsr3 A G 9: 108,829,068 T917A probably damaging Het
Clmn C A 12: 104,781,081 D736Y probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dennd4c G A 4: 86,786,094 R282H possibly damaging Het
Dsg1b T A 18: 20,396,480 N327K probably damaging Het
Eftud2 A T 11: 102,854,771 probably benign Het
Esyt1 G T 10: 128,518,994 S512R possibly damaging Het
Fam124b T C 1: 80,213,135 Y177C possibly damaging Het
Fbxl5 A T 5: 43,765,461 I205K probably damaging Het
Fcrl1 A G 3: 87,384,705 Y57C probably damaging Het
Gabpb1 A T 2: 126,652,251 D151E probably benign Het
Gcc2 C T 10: 58,270,171 L310F probably benign Het
Hsd11b1 C G 1: 193,240,327 E141Q probably damaging Het
Htr1b A G 9: 81,632,287 V89A probably benign Het
Ibsp A T 5: 104,310,151 T185S probably damaging Het
Igfn1 T C 1: 135,969,033 D1265G probably benign Het
Ints9 T C 14: 64,980,122 Y33H possibly damaging Het
Kif1a A T 1: 93,058,810 probably benign Het
Lama1 A T 17: 67,780,618 probably null Het
Lbp A T 2: 158,319,687 D223V probably damaging Het
Lck C A 4: 129,555,656 D283Y probably damaging Het
Lcmt2 A G 2: 121,139,828 F258S probably damaging Het
Lsg1 G T 16: 30,581,005 probably null Het
Maip1 T C 1: 57,413,395 probably benign Het
Mark3 T G 12: 111,633,746 I465S probably benign Het
Marveld2 C T 13: 100,600,998 V128I probably benign Het
Mcm3ap A G 10: 76,483,188 H750R possibly damaging Het
Mdn1 A T 4: 32,723,501 Q2479L probably null Het
Met A T 6: 17,531,504 K594* probably null Het
Pak2 G T 16: 32,037,295 S241R probably damaging Het
Plxna4 T C 6: 32,185,475 I1368V possibly damaging Het
Pparg T C 6: 115,439,999 I51T probably benign Het
Ppp1r18 A G 17: 35,868,703 E62G probably damaging Het
Prkag2 T C 5: 24,947,477 S86G possibly damaging Het
Rabgap1l A T 1: 160,702,390 I347K probably benign Het
Rdh1 A T 10: 127,763,072 M141L probably benign Het
Rfx2 A T 17: 56,804,326 I82N possibly damaging Het
Sh2b2 G A 5: 136,231,735 A209V possibly damaging Het
Sh3d19 G A 3: 86,126,644 R768H possibly damaging Het
Sh3rf1 C T 8: 61,384,862 P814S probably damaging Het
Shbg T A 11: 69,617,589 probably benign Het
Slc15a2 T C 16: 36,756,383 T430A probably benign Het
Slc17a3 A T 13: 23,855,608 I250F probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spg11 A G 2: 122,101,706 S552P probably damaging Het
Srpk2 A G 5: 23,514,026 I597T probably damaging Het
St6galnac1 T G 11: 116,769,271 N72T possibly damaging Het
Tecpr2 T A 12: 110,944,887 probably null Het
Tmem208 T A 8: 105,334,830 C163S possibly damaging Het
Tpte T C 8: 22,345,031 V401A probably damaging Het
Trhde A G 10: 114,446,188 W795R possibly damaging Het
Trpm3 G A 19: 22,889,445 probably null Het
Ttn T A 2: 76,795,719 T14999S possibly damaging Het
Txndc2 A T 17: 65,638,926 N85K probably benign Het
Yes1 A G 5: 32,653,163 Y192C probably damaging Het
Zan A G 5: 137,429,130 V2415A unknown Het
Zfp410 T A 12: 84,332,952 C311S probably damaging Het
Zfp51 A T 17: 21,456,380 M38L probably benign Het
Zfp808 C T 13: 62,172,900 R648* probably null Het
Zfp976 G T 7: 42,613,382 H344N probably damaging Het
Other mutations in Zfp560
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Zfp560 APN 9 20348808 missense probably benign 0.00
IGL02400:Zfp560 APN 9 20350600 missense possibly damaging 0.73
R0002:Zfp560 UTSW 9 20347517 missense probably damaging 1.00
R0004:Zfp560 UTSW 9 20347967 missense probably damaging 1.00
R0019:Zfp560 UTSW 9 20348360 missense probably benign 0.23
R1401:Zfp560 UTSW 9 20351853 missense possibly damaging 0.71
R1481:Zfp560 UTSW 9 20348790 missense probably benign
R1521:Zfp560 UTSW 9 20348775 unclassified probably null
R1579:Zfp560 UTSW 9 20347991 missense possibly damaging 0.73
R1673:Zfp560 UTSW 9 20347653 missense probably benign 0.37
R1694:Zfp560 UTSW 9 20347986 nonsense probably null
R1796:Zfp560 UTSW 9 20351930 missense possibly damaging 0.71
R2971:Zfp560 UTSW 9 20348944 missense probably benign 0.00
R3416:Zfp560 UTSW 9 20347678 nonsense probably null
R4182:Zfp560 UTSW 9 20347448 missense probably benign 0.11
R4509:Zfp560 UTSW 9 20348723 missense probably damaging 1.00
R4708:Zfp560 UTSW 9 20351918 missense possibly damaging 0.85
R4735:Zfp560 UTSW 9 20349051 missense probably benign 0.01
R4937:Zfp560 UTSW 9 20347967 missense probably damaging 1.00
R5562:Zfp560 UTSW 9 20350587 nonsense probably null
R6597:Zfp560 UTSW 9 20348001 missense probably benign 0.00
R6852:Zfp560 UTSW 9 20348043 missense probably damaging 0.99
R6863:Zfp560 UTSW 9 20348499 missense probably damaging 0.99
R7267:Zfp560 UTSW 9 20348088 missense probably damaging 0.96
R7619:Zfp560 UTSW 9 20348910 missense probably benign 0.01
R7763:Zfp560 UTSW 9 20347323 missense possibly damaging 0.96
R8220:Zfp560 UTSW 9 20349052 missense probably benign 0.00
Z1176:Zfp560 UTSW 9 20347704 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTGACACTCGAAGGGCTTCTCTC -3'
(R):5'- ACTGGTCCTGGATTACGCCAGTATG -3'

Sequencing Primer
(F):5'- gctttcccacactccttacattc -3'
(R):5'- GATTGCAAGTACAGCTTACCAG -3'
Posted On2014-04-24