Incidental Mutation 'R1569:Shbg'
ID177133
Institutional Source Beutler Lab
Gene Symbol Shbg
Ensembl Gene ENSMUSG00000005202
Gene Namesex hormone binding globulin
Synonyms
MMRRC Submission 039608-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R1569 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69614804-69617905 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 69617589 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005334] [ENSMUST00000092969] [ENSMUST00000108656]
Predicted Effect probably benign
Transcript: ENSMUST00000005334
SMART Domains Protein: ENSMUSP00000005334
Gene: ENSMUSG00000005202

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LamG 68 203 2.59e-21 SMART
LamG 249 372 7.71e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092969
SMART Domains Protein: ENSMUSP00000090647
Gene: ENSMUSG00000069835

DomainStartEndE-ValueType
Pfam:Acetyltransf_10 13 144 1.4e-8 PFAM
Pfam:Acetyltransf_7 63 145 3e-11 PFAM
Pfam:Acetyltransf_1 66 146 2.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108656
SMART Domains Protein: ENSMUSP00000104296
Gene: ENSMUSG00000069835

DomainStartEndE-ValueType
Pfam:Acetyltransf_7 53 144 3.2e-10 PFAM
Pfam:Acetyltransf_1 65 146 5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151255
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a steroid binding protein that was first described as a plasma protein secreted by the liver but is now thought to participate in the regulation of steroid responses. The encoded protein transports androgens and estrogens in the blood, binding each steroid molecule as a dimer formed from identical or nearly identical monomers. Polymorphisms in this gene have been associated with polycystic ovary syndrome and type 2 diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,797 K166* probably null Het
Abca2 T A 2: 25,439,185 N1012K probably benign Het
Ahnak T C 19: 9,004,094 V914A possibly damaging Het
Akap1 T A 11: 88,833,180 M833L probably benign Het
Atp2b1 T A 10: 98,987,326 H249Q probably benign Het
Atp6v0a4 A G 6: 38,050,625 V750A probably damaging Het
Car6 T C 4: 150,201,042 Y23C probably damaging Het
Celsr3 A G 9: 108,829,068 T917A probably damaging Het
Clmn C A 12: 104,781,081 D736Y probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dennd4c G A 4: 86,786,094 R282H possibly damaging Het
Dsg1b T A 18: 20,396,480 N327K probably damaging Het
Eftud2 A T 11: 102,854,771 probably benign Het
Esyt1 G T 10: 128,518,994 S512R possibly damaging Het
Fam124b T C 1: 80,213,135 Y177C possibly damaging Het
Fbxl5 A T 5: 43,765,461 I205K probably damaging Het
Fcrl1 A G 3: 87,384,705 Y57C probably damaging Het
Gabpb1 A T 2: 126,652,251 D151E probably benign Het
Gcc2 C T 10: 58,270,171 L310F probably benign Het
Hsd11b1 C G 1: 193,240,327 E141Q probably damaging Het
Htr1b A G 9: 81,632,287 V89A probably benign Het
Ibsp A T 5: 104,310,151 T185S probably damaging Het
Igfn1 T C 1: 135,969,033 D1265G probably benign Het
Ints9 T C 14: 64,980,122 Y33H possibly damaging Het
Kif1a A T 1: 93,058,810 probably benign Het
Lama1 A T 17: 67,780,618 probably null Het
Lbp A T 2: 158,319,687 D223V probably damaging Het
Lck C A 4: 129,555,656 D283Y probably damaging Het
Lcmt2 A G 2: 121,139,828 F258S probably damaging Het
Lsg1 G T 16: 30,581,005 probably null Het
Maip1 T C 1: 57,413,395 probably benign Het
Mark3 T G 12: 111,633,746 I465S probably benign Het
Marveld2 C T 13: 100,600,998 V128I probably benign Het
Mcm3ap A G 10: 76,483,188 H750R possibly damaging Het
Mdn1 A T 4: 32,723,501 Q2479L probably null Het
Met A T 6: 17,531,504 K594* probably null Het
Pak2 G T 16: 32,037,295 S241R probably damaging Het
Plxna4 T C 6: 32,185,475 I1368V possibly damaging Het
Pparg T C 6: 115,439,999 I51T probably benign Het
Ppp1r18 A G 17: 35,868,703 E62G probably damaging Het
Prkag2 T C 5: 24,947,477 S86G possibly damaging Het
Rabgap1l A T 1: 160,702,390 I347K probably benign Het
Rdh1 A T 10: 127,763,072 M141L probably benign Het
Rfx2 A T 17: 56,804,326 I82N possibly damaging Het
Sh2b2 G A 5: 136,231,735 A209V possibly damaging Het
Sh3d19 G A 3: 86,126,644 R768H possibly damaging Het
Sh3rf1 C T 8: 61,384,862 P814S probably damaging Het
Slc15a2 T C 16: 36,756,383 T430A probably benign Het
Slc17a3 A T 13: 23,855,608 I250F probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spg11 A G 2: 122,101,706 S552P probably damaging Het
Srpk2 A G 5: 23,514,026 I597T probably damaging Het
St6galnac1 T G 11: 116,769,271 N72T possibly damaging Het
Tecpr2 T A 12: 110,944,887 probably null Het
Tmem208 T A 8: 105,334,830 C163S possibly damaging Het
Tpte T C 8: 22,345,031 V401A probably damaging Het
Trhde A G 10: 114,446,188 W795R possibly damaging Het
Trpm3 G A 19: 22,889,445 probably null Het
Ttn T A 2: 76,795,719 T14999S possibly damaging Het
Txndc2 A T 17: 65,638,926 N85K probably benign Het
Yes1 A G 5: 32,653,163 Y192C probably damaging Het
Zan A G 5: 137,429,130 V2415A unknown Het
Zfp410 T A 12: 84,332,952 C311S probably damaging Het
Zfp51 A T 17: 21,456,380 M38L probably benign Het
Zfp560 A T 9: 20,348,715 C284S possibly damaging Het
Zfp808 C T 13: 62,172,900 R648* probably null Het
Zfp976 G T 7: 42,613,382 H344N probably damaging Het
Other mutations in Shbg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02212:Shbg APN 11 69617209 missense probably damaging 1.00
IGL03401:Shbg APN 11 69615099 missense probably damaging 1.00
R0102:Shbg UTSW 11 69617589 unclassified probably benign
R0102:Shbg UTSW 11 69617589 unclassified probably benign
R0968:Shbg UTSW 11 69617188 missense probably damaging 1.00
R1714:Shbg UTSW 11 69617157 missense possibly damaging 0.74
R1721:Shbg UTSW 11 69614972 missense probably damaging 0.97
R4735:Shbg UTSW 11 69617500 missense possibly damaging 0.64
R4903:Shbg UTSW 11 69615086 missense probably benign 0.00
R4956:Shbg UTSW 11 69617219 missense probably damaging 1.00
R5524:Shbg UTSW 11 69616762 missense probably benign 0.00
R5543:Shbg UTSW 11 69616738 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGGTTCGAAACTCAAAGGAGG -3'
(R):5'- TGTTGCTACTACTGATGCCGCC -3'

Sequencing Primer
(F):5'- CTCAAAGGAGGAATGGGGTCTG -3'
(R):5'- TGACCCTGGAACTGTACCTTTC -3'
Posted On2014-04-24