Mutagenetix > Incidental Mutations

Incidental Mutation 'R1570:Cep170'

177159

Institutional Source

Beutler Lab

Gene Symbol

Cep170

Ensembl Gene

ENSMUSG00000057335

Gene Name

centrosomal protein 170

Synonyms

4933426L22Rik, A330004A13Rik

MMRRC Submission

039609-MU

Accession Numbers

Ncbi RefSeq: NM_001099637.2; MGI:1918348

Is this an essential gene?

Possibly essential (E-score: 0.546) question?

Stock #

R1570 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

176733653-176814067 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 176755801 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1004 (I1004T)

Ref Sequence

ENSEMBL: ENSMUSP00000141793 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057037] [ENSMUST00000192927] [ENSMUST00000194727] [ENSMUST00000195433] [ENSMUST00000195717]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000057037
AA Change: I1004T

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000059562
Gene: ENSMUSG00000057335
AA Change: I1004T

Domain	Start	End	E-Value	Type
FHA	22	73	1.27e-7	SMART
low complexity region	118	133	N/A	INTRINSIC
low complexity region	717	731	N/A	INTRINSIC
low complexity region	738	750	N/A	INTRINSIC
low complexity region	770	782	N/A	INTRINSIC
Pfam:CEP170_C	801	1496	3.3e-264	PFAM
low complexity region	1533	1545	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000192664

Predicted Effect

probably benign
Transcript: ENSMUST00000192927
AA Change: I239T

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000142032
Gene: ENSMUSG00000057335
AA Change: I239T

Domain	Start	End	E-Value	Type
low complexity region	5	17	N/A	INTRINSIC
Pfam:CEP170_C	30	469	3.4e-129	PFAM
Pfam:CEP170_C	449	708	7.4e-102	PFAM
low complexity region	742	754	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000194727
AA Change: I1004T

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000141793
Gene: ENSMUSG00000057335
AA Change: I1004T

Domain	Start	End	E-Value	Type
FHA	22	73	1.27e-7	SMART
low complexity region	118	133	N/A	INTRINSIC
low complexity region	717	731	N/A	INTRINSIC
low complexity region	738	750	N/A	INTRINSIC
low complexity region	770	782	N/A	INTRINSIC
Pfam:CEP170_C	795	1509	8e-260	PFAM
low complexity region	1543	1555	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194984

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195121

Predicted Effect

probably benign
Transcript: ENSMUST00000195433

SMART Domains

Protein: ENSMUSP00000142108
Gene: ENSMUSG00000057335

Domain	Start	End	E-Value	Type
FHA	22	73	6.1e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195463

Predicted Effect

possibly damaging
Transcript: ENSMUST00000195717
AA Change: I1004T

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000141769
Gene: ENSMUSG00000057335
AA Change: I1004T

Domain	Start	End	E-Value	Type
FHA	22	73	1.27e-7	SMART
low complexity region	118	133	N/A	INTRINSIC
low complexity region	717	731	N/A	INTRINSIC
low complexity region	738	750	N/A	INTRINSIC
low complexity region	770	782	N/A	INTRINSIC
Pfam:CEP170_C	795	1499	1.8e-261	PFAM
low complexity region	1533	1545	N/A	INTRINSIC

Meta Mutation Damage Score

0.0850

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.0%

Validation Efficiency

93% (77/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. During interphase, the encoded protein localizes to the sub-distal appendages of mature centrioles, which are microtubule-based structures thought to help organize centrosomes. During mitosis, the protein associates with spindle microtubules near the centrosomes. The protein interacts with and is phosphorylated by polo-like kinase 1, and functions in maintaining microtubule organization and cell morphology. The human genome contains a putative transcribed pseudogene. Several alternatively spliced transcript variants of this gene have been found, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(29) : Gene trapped(29)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apobec1	A	G	6: 122,591,085		probably null	Het
Arhgap21	G	T	2: 20,880,840	Q348K	probably benign	Het
Arl5c	A	G	11: 97,992,387	V129A	probably benign	Het
Armh1	A	G	4: 117,229,992	S159P	probably damaging	Het
Asb8	A	G	15: 98,136,428	L82P	probably damaging	Het
Bahcc1	G	A	11: 120,272,183	A436T	possibly damaging	Het
Btc	T	C	5: 91,402,717	D2G	unknown	Het
C1s2	G	A	6: 124,625,764	T490M	probably benign	Het
Caap1	C	T	4: 94,556,577	G43D	probably benign	Het
Ccr5	T	C	9: 124,124,963	V201A	probably benign	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Cdhr5	C	A	7: 141,271,769	G541C	probably damaging	Het
Chd9	A	T	8: 91,036,542	M2332L	probably benign	Het
Clk1	T	A	1: 58,414,425	H334L	probably benign	Het
Cyp4b1	G	A	4: 115,635,963	S228F	probably benign	Het
Dnah9	T	C	11: 66,112,330	N883D	probably benign	Het
Dync2h1	A	G	9: 7,176,926	L11P	probably benign	Het
Ephx4	A	G	5: 107,419,851	E225G	probably damaging	Het
Erich6	C	T	3: 58,630,659		probably null	Het
Espl1	A	G	15: 102,298,367	T89A	probably damaging	Het
Evi2	T	A	11: 79,516,250	K166N	possibly damaging	Het
Glrx5	A	G	12: 105,032,868	T57A	possibly damaging	Het
Gm15448	T	C	7: 3,823,061	E311G	probably benign	Het
Gm884	A	G	11: 103,609,938	Y597H	possibly damaging	Het
Gnptab	T	A	10: 88,419,454	V222E	probably damaging	Het
Gpr155	T	C	2: 73,370,038	Y375C	possibly damaging	Het
Hsd11b1	C	G	1: 193,240,327	E141Q	probably damaging	Het
Ildr2	T	C	1: 166,303,585	F337L	probably damaging	Het
Ino80	C	T	2: 119,447,028	R322Q	possibly damaging	Het
Lcp2	A	G	11: 34,089,601	D467G	probably benign	Het
Lmbr1	A	G	5: 29,254,558	I229T	probably damaging	Het
Lnpep	A	T	17: 17,579,156	M79K	probably damaging	Het
Lpin1	T	C	12: 16,560,998	Q564R	possibly damaging	Het
Lpin2	T	A	17: 71,245,181	L794*	probably null	Het
Lrrc45	T	C	11: 120,720,109		probably null	Het
Mtus1	A	G	8: 41,076,241	S751P	probably damaging	Het
Nbr1	T	C	11: 101,564,830		probably benign	Het
Nup107	A	G	10: 117,763,844	F592S	possibly damaging	Het
Nup133	T	A	8: 123,949,176	M1L	possibly damaging	Het
Olfr1104	A	T	2: 87,022,272	S91T	probably benign	Het
Olfr1208	A	C	2: 88,896,946	I217S	probably damaging	Het
Olfr139	A	C	11: 74,044,807	F156V	possibly damaging	Het
Olfr434	T	C	6: 43,217,351	V146A	probably benign	Het
Olfr548-ps1	C	A	7: 102,541,970	H11Q	probably damaging	Het
Olfr732	T	G	14: 50,281,524	H243P	probably damaging	Het
Otud7b	T	C	3: 96,155,891	C816R	probably damaging	Het
Pi4k2a	T	C	19: 42,100,644	V148A	probably benign	Het
Pih1d2	T	C	9: 50,621,179	M195T	probably benign	Het
Plpp6	T	C	19: 28,964,778	F260L	probably damaging	Het
R3hcc1l	A	T	19: 42,581,954	T663S	probably damaging	Het
Rnf25	T	C	1: 74,595,267	E199G	probably damaging	Het
Scin	G	A	12: 40,084,381		probably benign	Het
Serpinb1c	A	T	13: 32,896,990	S37T	probably benign	Het
Snx19	A	G	9: 30,428,343	D259G	probably damaging	Het
Sorcs3	A	G	19: 48,764,181	K805R	probably damaging	Het
Sox6	C	A	7: 115,777,123	G125W	probably damaging	Het
Spink5	A	G	18: 43,967,107	I64V	probably benign	Het
St6galnac1	A	G	11: 116,766,648		probably benign	Het
Sult1c2	T	C	17: 53,836,963	I105V	probably benign	Het
Tacr3	T	G	3: 134,829,756	S162A	probably damaging	Het
Tex43	T	A	18: 56,594,534	D101E	probably benign	Het
Ttc6	T	C	12: 57,674,763	S1013P	probably damaging	Het
Zbtb11	C	A	16: 55,990,815	N445K	probably benign	Het
Zfp423	A	C	8: 87,782,558	V261G	probably benign	Het
Zfp59	T	C	7: 27,853,591	V156A	probably benign	Het
Zscan2	C	A	7: 80,863,393	A42E	probably damaging	Het

Other mutations in Cep170

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00773:Cep170	APN	1	176755399	missense	probably damaging	1.00
IGL00925:Cep170	APN	1	176793524	missense	probably damaging	1.00
IGL00972:Cep170	APN	1	176735696	missense	probably benign	0.00
IGL01488:Cep170	APN	1	176756375	missense	probably benign	0.00
IGL01916:Cep170	APN	1	176739910	splice site	probably benign
IGL02212:Cep170	APN	1	176735936	missense	probably damaging	0.99
IGL02269:Cep170	APN	1	176769366	missense	probably benign
IGL02732:Cep170	APN	1	176736874	missense	probably damaging	1.00
IGL02740:Cep170	APN	1	176793600	missense	probably damaging	1.00
IGL02812:Cep170	APN	1	176742514	missense	probably damaging	1.00
IGL03036:Cep170	APN	1	176769337	missense	possibly damaging	0.87
IGL03201:Cep170	APN	1	176736888	missense	probably damaging	1.00
IGL03333:Cep170	APN	1	176769526	missense	possibly damaging	0.64
PIT4520001:Cep170	UTSW	1	176780199	missense	unknown
R0031:Cep170	UTSW	1	176756091	missense	probably damaging	1.00
R0039:Cep170	UTSW	1	176782495	critical splice donor site	probably null
R0053:Cep170	UTSW	1	176782380	missense	possibly damaging	0.82
R0053:Cep170	UTSW	1	176782380	missense	possibly damaging	0.82
R0113:Cep170	UTSW	1	176758455	missense	probably damaging	0.97
R0144:Cep170	UTSW	1	176792595	missense	probably benign	0.01
R0613:Cep170	UTSW	1	176774680	missense	probably benign
R0755:Cep170	UTSW	1	176755753	missense	probably damaging	1.00
R1132:Cep170	UTSW	1	176750037	missense	probably damaging	1.00
R1367:Cep170	UTSW	1	176735724	missense	probably damaging	0.99
R1399:Cep170	UTSW	1	176758403	missense	probably damaging	0.98
R1462:Cep170	UTSW	1	176756645	missense	possibly damaging	0.46
R1462:Cep170	UTSW	1	176756645	missense	possibly damaging	0.46
R1481:Cep170	UTSW	1	176782385	missense	possibly damaging	0.56
R1526:Cep170	UTSW	1	176788505	missense	probably damaging	1.00
R1540:Cep170	UTSW	1	176739932	missense	probably damaging	1.00
R1552:Cep170	UTSW	1	176782494	splice site	probably benign
R1846:Cep170	UTSW	1	176755769	missense	probably damaging	1.00
R1884:Cep170	UTSW	1	176774679	missense	probably benign	0.12
R1945:Cep170	UTSW	1	176793534	nonsense	probably null
R1954:Cep170	UTSW	1	176756384	missense	probably benign
R1957:Cep170	UTSW	1	176769447	missense	probably benign	0.24
R2184:Cep170	UTSW	1	176756976	missense	probably benign	0.00
R2280:Cep170	UTSW	1	176774505	missense	probably benign	0.17
R2426:Cep170	UTSW	1	176774635	missense	probably benign
R3415:Cep170	UTSW	1	176756044	missense	probably damaging	1.00
R3417:Cep170	UTSW	1	176756044	missense	probably damaging	1.00
R3752:Cep170	UTSW	1	176782495	critical splice donor site	probably benign
R3848:Cep170	UTSW	1	176755843	missense	probably benign	0.14
R3849:Cep170	UTSW	1	176755843	missense	probably benign	0.14
R4752:Cep170	UTSW	1	176756688	missense	probably benign	0.00
R4910:Cep170	UTSW	1	176782263	missense	possibly damaging	0.94
R5007:Cep170	UTSW	1	176769814	missense	probably benign	0.28
R5052:Cep170	UTSW	1	176793551	missense	probably damaging	1.00
R5093:Cep170	UTSW	1	176769330	missense	possibly damaging	0.95
R5530:Cep170	UTSW	1	176769510	missense	probably benign	0.00
R5622:Cep170	UTSW	1	176735867	missense	possibly damaging	0.64
R5892:Cep170	UTSW	1	176755387	unclassified	probably null
R5942:Cep170	UTSW	1	176756419	missense	probably damaging	1.00
R6083:Cep170	UTSW	1	176774625	missense	probably damaging	1.00
R6091:Cep170	UTSW	1	176755831	missense	probably damaging	0.98
R6190:Cep170	UTSW	1	176782409	missense	probably damaging	1.00
R6253:Cep170	UTSW	1	176780394	missense	possibly damaging	0.71
R6476:Cep170	UTSW	1	176780351	missense	possibly damaging	0.72
R6622:Cep170	UTSW	1	176756332	missense	probably damaging	1.00
R6932:Cep170	UTSW	1	176761437	missense	possibly damaging	0.90
R7030:Cep170	UTSW	1	176756485	missense	probably damaging	0.99
R7163:Cep170	UTSW	1	176774465	missense	probably damaging	1.00
R7352:Cep170	UTSW	1	176769857	missense	probably benign	0.11
R7499:Cep170	UTSW	1	176774462	missense	probably damaging	1.00
R7502:Cep170	UTSW	1	176756029	missense	probably damaging	1.00
R7773:Cep170	UTSW	1	176740076	missense
R8043:Cep170	UTSW	1	176769242	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TGTCAGCATCAGCAAGTTCACTGTC -3'
(R):5'- CACGCAAAAGCGGAAGAGTTTCAC -3'

Sequencing Primer
(F):5'- TCAGCAAGTTCACTGTCAGAAG -3'
(R):5'- AGCGGAAGAGTTTCACTAGTCTC -3'

Posted On

2014-04-24