Incidental Mutation 'R1570:Olfr1208'
ID177164
Institutional Source Beutler Lab
Gene Symbol Olfr1208
Ensembl Gene ENSMUSG00000075114
Gene Nameolfactory receptor 1208
SynonymsMOR225-4, GA_x6K02T2Q125-50372411-50371485
MMRRC Submission 039609-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R1570 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88895575-88902311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 88896946 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 217 (I217S)
Ref Sequence ENSEMBL: ENSMUSP00000149695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099810] [ENSMUST00000214121] [ENSMUST00000214297]
Predicted Effect probably damaging
Transcript: ENSMUST00000099810
AA Change: I217S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097398
Gene: ENSMUSG00000075114
AA Change: I217S

DomainStartEndE-ValueType
Pfam:7tm_4 28 302 1.9e-48 PFAM
Pfam:7tm_1 38 284 2.6e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214121
AA Change: I217S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214297
AA Change: I217S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0384 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.0%
Validation Efficiency 93% (77/83)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobec1 A G 6: 122,591,085 probably null Het
Arhgap21 G T 2: 20,880,840 Q348K probably benign Het
Arl5c A G 11: 97,992,387 V129A probably benign Het
Armh1 A G 4: 117,229,992 S159P probably damaging Het
Asb8 A G 15: 98,136,428 L82P probably damaging Het
Bahcc1 G A 11: 120,272,183 A436T possibly damaging Het
Btc T C 5: 91,402,717 D2G unknown Het
C1s2 G A 6: 124,625,764 T490M probably benign Het
Caap1 C T 4: 94,556,577 G43D probably benign Het
Ccr5 T C 9: 124,124,963 V201A probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdhr5 C A 7: 141,271,769 G541C probably damaging Het
Cep170 A G 1: 176,755,801 I1004T possibly damaging Het
Chd9 A T 8: 91,036,542 M2332L probably benign Het
Clk1 T A 1: 58,414,425 H334L probably benign Het
Cyp4b1 G A 4: 115,635,963 S228F probably benign Het
Dnah9 T C 11: 66,112,330 N883D probably benign Het
Dync2h1 A G 9: 7,176,926 L11P probably benign Het
Ephx4 A G 5: 107,419,851 E225G probably damaging Het
Erich6 C T 3: 58,630,659 probably null Het
Espl1 A G 15: 102,298,367 T89A probably damaging Het
Evi2 T A 11: 79,516,250 K166N possibly damaging Het
Glrx5 A G 12: 105,032,868 T57A possibly damaging Het
Gm15448 T C 7: 3,823,061 E311G probably benign Het
Gm884 A G 11: 103,609,938 Y597H possibly damaging Het
Gnptab T A 10: 88,419,454 V222E probably damaging Het
Gpr155 T C 2: 73,370,038 Y375C possibly damaging Het
Hsd11b1 C G 1: 193,240,327 E141Q probably damaging Het
Ildr2 T C 1: 166,303,585 F337L probably damaging Het
Ino80 C T 2: 119,447,028 R322Q possibly damaging Het
Lcp2 A G 11: 34,089,601 D467G probably benign Het
Lmbr1 A G 5: 29,254,558 I229T probably damaging Het
Lnpep A T 17: 17,579,156 M79K probably damaging Het
Lpin1 T C 12: 16,560,998 Q564R possibly damaging Het
Lpin2 T A 17: 71,245,181 L794* probably null Het
Lrrc45 T C 11: 120,720,109 probably null Het
Mtus1 A G 8: 41,076,241 S751P probably damaging Het
Nbr1 T C 11: 101,564,830 probably benign Het
Nup107 A G 10: 117,763,844 F592S possibly damaging Het
Nup133 T A 8: 123,949,176 M1L possibly damaging Het
Olfr1104 A T 2: 87,022,272 S91T probably benign Het
Olfr139 A C 11: 74,044,807 F156V possibly damaging Het
Olfr434 T C 6: 43,217,351 V146A probably benign Het
Olfr548-ps1 C A 7: 102,541,970 H11Q probably damaging Het
Olfr732 T G 14: 50,281,524 H243P probably damaging Het
Otud7b T C 3: 96,155,891 C816R probably damaging Het
Pi4k2a T C 19: 42,100,644 V148A probably benign Het
Pih1d2 T C 9: 50,621,179 M195T probably benign Het
Plpp6 T C 19: 28,964,778 F260L probably damaging Het
R3hcc1l A T 19: 42,581,954 T663S probably damaging Het
Rnf25 T C 1: 74,595,267 E199G probably damaging Het
Scin G A 12: 40,084,381 probably benign Het
Serpinb1c A T 13: 32,896,990 S37T probably benign Het
Snx19 A G 9: 30,428,343 D259G probably damaging Het
Sorcs3 A G 19: 48,764,181 K805R probably damaging Het
Sox6 C A 7: 115,777,123 G125W probably damaging Het
Spink5 A G 18: 43,967,107 I64V probably benign Het
St6galnac1 A G 11: 116,766,648 probably benign Het
Sult1c2 T C 17: 53,836,963 I105V probably benign Het
Tacr3 T G 3: 134,829,756 S162A probably damaging Het
Tex43 T A 18: 56,594,534 D101E probably benign Het
Ttc6 T C 12: 57,674,763 S1013P probably damaging Het
Zbtb11 C A 16: 55,990,815 N445K probably benign Het
Zfp423 A C 8: 87,782,558 V261G probably benign Het
Zfp59 T C 7: 27,853,591 V156A probably benign Het
Zscan2 C A 7: 80,863,393 A42E probably damaging Het
Other mutations in Olfr1208
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Olfr1208 APN 2 88896977 missense probably damaging 1.00
IGL02132:Olfr1208 APN 2 88897159 missense probably benign
IGL02374:Olfr1208 APN 2 88897459 missense probably damaging 1.00
R1378:Olfr1208 UTSW 2 88897026 missense probably benign 0.01
R2056:Olfr1208 UTSW 2 88896761 missense probably damaging 1.00
R2092:Olfr1208 UTSW 2 88897267 missense probably damaging 0.99
R2185:Olfr1208 UTSW 2 88896703 missense probably damaging 0.99
R5223:Olfr1208 UTSW 2 88897334 missense probably benign 0.03
R5479:Olfr1208 UTSW 2 88896691 missense probably benign 0.13
R6463:Olfr1208 UTSW 2 88897118 missense probably benign 0.00
R6859:Olfr1208 UTSW 2 88896934 missense probably benign
R7347:Olfr1208 UTSW 2 88897271 missense possibly damaging 0.51
R7352:Olfr1208 UTSW 2 88896718 missense probably damaging 1.00
R7544:Olfr1208 UTSW 2 88897361 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCAAACACCTTGTCGTCCC -3'
(R):5'- TCTCCTACAATGGCTGCATAGCCC -3'

Sequencing Primer
(F):5'- TTGTCGTCCCCAACAGAATC -3'
(R):5'- ACATCCTTGTGATAGGCTCAG -3'
Posted On2014-04-24