Incidental Mutation 'R1570:Lmbr1'
ID177171
Institutional Source Beutler Lab
Gene Symbol Lmbr1
Ensembl Gene ENSMUSG00000010721
Gene Namelimb region 1
Synonyms1110048D14Rik
MMRRC Submission 039609-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1570 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location29229802-29378390 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29254558 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 229 (I229T)
Ref Sequence ENSEMBL: ENSMUSP00000143316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055195] [ENSMUST00000179191] [ENSMUST00000196321] [ENSMUST00000198105] [ENSMUST00000200564]
Predicted Effect probably damaging
Transcript: ENSMUST00000055195
AA Change: I352T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058405
Gene: ENSMUSG00000010721
AA Change: I352T

DomainStartEndE-ValueType
Pfam:LMBR1 26 281 3.5e-46 PFAM
Pfam:LMBR1 239 445 1.7e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179191
AA Change: I324T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136160
Gene: ENSMUSG00000010721
AA Change: I324T

DomainStartEndE-ValueType
Pfam:LMBR1 23 108 6e-31 PFAM
Pfam:LMBR1 106 418 5.3e-99 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196321
AA Change: I229T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143348
Gene: ENSMUSG00000010721
AA Change: I229T

DomainStartEndE-ValueType
Pfam:LMBR1 1 323 4e-106 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000198105
AA Change: I325T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142755
Gene: ENSMUSG00000010721
AA Change: I325T

DomainStartEndE-ValueType
Pfam:LMBR1 23 107 5.4e-30 PFAM
Pfam:LMBR1 106 419 3.4e-101 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198367
Predicted Effect probably benign
Transcript: ENSMUST00000200149
Predicted Effect probably damaging
Transcript: ENSMUST00000200564
AA Change: I229T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143316
Gene: ENSMUSG00000010721
AA Change: I229T

DomainStartEndE-ValueType
Pfam:LMBR1 1 310 8.6e-92 PFAM
Meta Mutation Damage Score 0.314 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.0%
Validation Efficiency 93% (77/83)
MGI Phenotype FUNCTION: This gene encodes a member of the LMBR1-like membrane protein family. Another member of this protein family has been shown to be a lipocalin transmembrane receptor. A highly conserved, cis-acting regulatory module for the sonic hedgehog gene is located within an intron of this gene. Consequently, disruption of this genic region can alter sonic hedgehog expression and affect limb patterning, but it is not known if this gene functions directly in limb development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show minor coalitions of distal wrist bones and a low incidence of limb defects, including oligodactyly, brachyphalangia, and soft tissue or bony syndactyly. Homozygotes for another null allele exhibit normal morphology,clinical chemistry, hematology and behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobec1 A G 6: 122,591,085 probably null Het
Arhgap21 G T 2: 20,880,840 Q348K probably benign Het
Arl5c A G 11: 97,992,387 V129A probably benign Het
Armh1 A G 4: 117,229,992 S159P probably damaging Het
Asb8 A G 15: 98,136,428 L82P probably damaging Het
Bahcc1 G A 11: 120,272,183 A436T possibly damaging Het
Btc T C 5: 91,402,717 D2G unknown Het
C1s2 G A 6: 124,625,764 T490M probably benign Het
Caap1 C T 4: 94,556,577 G43D probably benign Het
Ccr5 T C 9: 124,124,963 V201A probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdhr5 C A 7: 141,271,769 G541C probably damaging Het
Cep170 A G 1: 176,755,801 I1004T possibly damaging Het
Chd9 A T 8: 91,036,542 M2332L probably benign Het
Clk1 T A 1: 58,414,425 H334L probably benign Het
Cyp4b1 G A 4: 115,635,963 S228F probably benign Het
Dnah9 T C 11: 66,112,330 N883D probably benign Het
Dync2h1 A G 9: 7,176,926 L11P probably benign Het
Ephx4 A G 5: 107,419,851 E225G probably damaging Het
Erich6 C T 3: 58,630,659 probably null Het
Espl1 A G 15: 102,298,367 T89A probably damaging Het
Evi2 T A 11: 79,516,250 K166N possibly damaging Het
Glrx5 A G 12: 105,032,868 T57A possibly damaging Het
Gm15448 T C 7: 3,823,061 E311G probably benign Het
Gm884 A G 11: 103,609,938 Y597H possibly damaging Het
Gnptab T A 10: 88,419,454 V222E probably damaging Het
Gpr155 T C 2: 73,370,038 Y375C possibly damaging Het
Hsd11b1 C G 1: 193,240,327 E141Q probably damaging Het
Ildr2 T C 1: 166,303,585 F337L probably damaging Het
Ino80 C T 2: 119,447,028 R322Q possibly damaging Het
Lcp2 A G 11: 34,089,601 D467G probably benign Het
Lnpep A T 17: 17,579,156 M79K probably damaging Het
Lpin1 T C 12: 16,560,998 Q564R possibly damaging Het
Lpin2 T A 17: 71,245,181 L794* probably null Het
Lrrc45 T C 11: 120,720,109 probably null Het
Mtus1 A G 8: 41,076,241 S751P probably damaging Het
Nbr1 T C 11: 101,564,830 probably benign Het
Nup107 A G 10: 117,763,844 F592S possibly damaging Het
Nup133 T A 8: 123,949,176 M1L possibly damaging Het
Olfr1104 A T 2: 87,022,272 S91T probably benign Het
Olfr1208 A C 2: 88,896,946 I217S probably damaging Het
Olfr139 A C 11: 74,044,807 F156V possibly damaging Het
Olfr434 T C 6: 43,217,351 V146A probably benign Het
Olfr548-ps1 C A 7: 102,541,970 H11Q probably damaging Het
Olfr732 T G 14: 50,281,524 H243P probably damaging Het
Otud7b T C 3: 96,155,891 C816R probably damaging Het
Pi4k2a T C 19: 42,100,644 V148A probably benign Het
Pih1d2 T C 9: 50,621,179 M195T probably benign Het
Plpp6 T C 19: 28,964,778 F260L probably damaging Het
R3hcc1l A T 19: 42,581,954 T663S probably damaging Het
Rnf25 T C 1: 74,595,267 E199G probably damaging Het
Scin G A 12: 40,084,381 probably benign Het
Serpinb1c A T 13: 32,896,990 S37T probably benign Het
Snx19 A G 9: 30,428,343 D259G probably damaging Het
Sorcs3 A G 19: 48,764,181 K805R probably damaging Het
Sox6 C A 7: 115,777,123 G125W probably damaging Het
Spink5 A G 18: 43,967,107 I64V probably benign Het
St6galnac1 A G 11: 116,766,648 probably benign Het
Sult1c2 T C 17: 53,836,963 I105V probably benign Het
Tacr3 T G 3: 134,829,756 S162A probably damaging Het
Tex43 T A 18: 56,594,534 D101E probably benign Het
Ttc6 T C 12: 57,674,763 S1013P probably damaging Het
Zbtb11 C A 16: 55,990,815 N445K probably benign Het
Zfp423 A C 8: 87,782,558 V261G probably benign Het
Zfp59 T C 7: 27,853,591 V156A probably benign Het
Zscan2 C A 7: 80,863,393 A42E probably damaging Het
Other mutations in Lmbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01645:Lmbr1 APN 5 29235055 missense probably damaging 1.00
IGL02285:Lmbr1 APN 5 29254235 splice site probably benign
IGL02793:Lmbr1 APN 5 29292188 missense probably damaging 1.00
IGL02875:Lmbr1 APN 5 29292188 missense probably damaging 1.00
IGL03103:Lmbr1 APN 5 29235016 missense probably damaging 0.99
IGL02988:Lmbr1 UTSW 5 29292223 splice site probably null
R0255:Lmbr1 UTSW 5 29252755 missense probably damaging 1.00
R0594:Lmbr1 UTSW 5 29292209 missense possibly damaging 0.87
R0993:Lmbr1 UTSW 5 29287393 missense probably damaging 1.00
R1036:Lmbr1 UTSW 5 29258747 missense probably damaging 1.00
R1724:Lmbr1 UTSW 5 29361083 missense probably benign 0.03
R2056:Lmbr1 UTSW 5 29233094 missense probably benign 0.07
R2996:Lmbr1 UTSW 5 29363933 missense probably benign 0.29
R4082:Lmbr1 UTSW 5 29258755 missense probably damaging 1.00
R4618:Lmbr1 UTSW 5 29346865 missense probably damaging 1.00
R4842:Lmbr1 UTSW 5 29287426 missense probably damaging 0.97
R4857:Lmbr1 UTSW 5 29323809 missense probably damaging 0.98
R5495:Lmbr1 UTSW 5 29346853 nonsense probably null
R5647:Lmbr1 UTSW 5 29263393 critical splice donor site probably null
R6393:Lmbr1 UTSW 5 29254294 missense probably damaging 1.00
R6466:Lmbr1 UTSW 5 29378168 missense probably benign 0.05
R6486:Lmbr1 UTSW 5 29323861 missense probably damaging 0.99
R6576:Lmbr1 UTSW 5 29291310 missense probably damaging 1.00
R6874:Lmbr1 UTSW 5 29292906 missense probably damaging 1.00
R7085:Lmbr1 UTSW 5 29361092 splice site probably null
R7484:Lmbr1 UTSW 5 29346852 start gained probably benign
R7487:Lmbr1 UTSW 5 29254264 missense probably benign 0.38
Z1088:Lmbr1 UTSW 5 29323816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACACTTCCCAAAGTCTAAAGCC -3'
(R):5'- ACCTCCCCAGTGAGCAgtacc -3'

Sequencing Primer
(F):5'- TTCCCAAAGTCTAAAGCCCATAGG -3'
(R):5'- gggaaatgagagggatagtgag -3'
Posted On2014-04-24