Incidental Mutation 'R1570:Cdhr5'
ID177183
Institutional Source Beutler Lab
Gene Symbol Cdhr5
Ensembl Gene ENSMUSG00000025497
Gene Namecadherin-related family member 5
Synonyms1810074H01Rik, Mupcdh, Mucdhl
MMRRC Submission 039609-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R1570 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141269083-141276786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 141271769 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 541 (G541C)
Ref Sequence ENSEMBL: ENSMUSP00000127292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080654] [ENSMUST00000167263] [ENSMUST00000210124] [ENSMUST00000210773]
Predicted Effect probably benign
Transcript: ENSMUST00000080654
SMART Domains Protein: ENSMUSP00000079484
Gene: ENSMUSG00000025497

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 53 125 3.78e-2 SMART
CA 152 238 2.34e-1 SMART
Blast:CA 277 355 3e-35 BLAST
Blast:CA 388 458 3e-24 BLAST
transmembrane domain 478 500 N/A INTRINSIC
low complexity region 546 580 N/A INTRINSIC
low complexity region 634 653 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167263
AA Change: G541C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127292
Gene: ENSMUSG00000025497
AA Change: G541C

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 53 125 3.78e-2 SMART
CA 152 238 2.34e-1 SMART
Blast:CA 277 355 3e-35 BLAST
Blast:CA 388 458 1e-24 BLAST
low complexity region 462 476 N/A INTRINSIC
low complexity region 496 518 N/A INTRINSIC
low complexity region 520 544 N/A INTRINSIC
low complexity region 559 576 N/A INTRINSIC
transmembrane domain 640 662 N/A INTRINSIC
low complexity region 708 742 N/A INTRINSIC
low complexity region 796 815 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210386
Predicted Effect probably benign
Transcript: ENSMUST00000210773
Meta Mutation Damage Score 0.1267 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.0%
Validation Efficiency 93% (77/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a novel mucin-like gene that is a member of the cadherin superfamily. While encoding nonpolymorphic tandem repeats rich in proline, serine and threonine similar to mucin proteins, the gene also contains sequence encoding calcium-binding motifs found in all cadherins. The role of the hybrid extracellular region and the specific function of this protein have not yet been determined. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobec1 A G 6: 122,591,085 probably null Het
Arhgap21 G T 2: 20,880,840 Q348K probably benign Het
Arl5c A G 11: 97,992,387 V129A probably benign Het
Armh1 A G 4: 117,229,992 S159P probably damaging Het
Asb8 A G 15: 98,136,428 L82P probably damaging Het
Bahcc1 G A 11: 120,272,183 A436T possibly damaging Het
Btc T C 5: 91,402,717 D2G unknown Het
C1s2 G A 6: 124,625,764 T490M probably benign Het
Caap1 C T 4: 94,556,577 G43D probably benign Het
Ccr5 T C 9: 124,124,963 V201A probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cep170 A G 1: 176,755,801 I1004T possibly damaging Het
Chd9 A T 8: 91,036,542 M2332L probably benign Het
Clk1 T A 1: 58,414,425 H334L probably benign Het
Cyp4b1 G A 4: 115,635,963 S228F probably benign Het
Dnah9 T C 11: 66,112,330 N883D probably benign Het
Dync2h1 A G 9: 7,176,926 L11P probably benign Het
Ephx4 A G 5: 107,419,851 E225G probably damaging Het
Erich6 C T 3: 58,630,659 probably null Het
Espl1 A G 15: 102,298,367 T89A probably damaging Het
Evi2 T A 11: 79,516,250 K166N possibly damaging Het
Glrx5 A G 12: 105,032,868 T57A possibly damaging Het
Gm15448 T C 7: 3,823,061 E311G probably benign Het
Gm884 A G 11: 103,609,938 Y597H possibly damaging Het
Gnptab T A 10: 88,419,454 V222E probably damaging Het
Gpr155 T C 2: 73,370,038 Y375C possibly damaging Het
Hsd11b1 C G 1: 193,240,327 E141Q probably damaging Het
Ildr2 T C 1: 166,303,585 F337L probably damaging Het
Ino80 C T 2: 119,447,028 R322Q possibly damaging Het
Lcp2 A G 11: 34,089,601 D467G probably benign Het
Lmbr1 A G 5: 29,254,558 I229T probably damaging Het
Lnpep A T 17: 17,579,156 M79K probably damaging Het
Lpin1 T C 12: 16,560,998 Q564R possibly damaging Het
Lpin2 T A 17: 71,245,181 L794* probably null Het
Lrrc45 T C 11: 120,720,109 probably null Het
Mtus1 A G 8: 41,076,241 S751P probably damaging Het
Nbr1 T C 11: 101,564,830 probably benign Het
Nup107 A G 10: 117,763,844 F592S possibly damaging Het
Nup133 T A 8: 123,949,176 M1L possibly damaging Het
Olfr1104 A T 2: 87,022,272 S91T probably benign Het
Olfr1208 A C 2: 88,896,946 I217S probably damaging Het
Olfr139 A C 11: 74,044,807 F156V possibly damaging Het
Olfr434 T C 6: 43,217,351 V146A probably benign Het
Olfr548-ps1 C A 7: 102,541,970 H11Q probably damaging Het
Olfr732 T G 14: 50,281,524 H243P probably damaging Het
Otud7b T C 3: 96,155,891 C816R probably damaging Het
Pi4k2a T C 19: 42,100,644 V148A probably benign Het
Pih1d2 T C 9: 50,621,179 M195T probably benign Het
Plpp6 T C 19: 28,964,778 F260L probably damaging Het
R3hcc1l A T 19: 42,581,954 T663S probably damaging Het
Rnf25 T C 1: 74,595,267 E199G probably damaging Het
Scin G A 12: 40,084,381 probably benign Het
Serpinb1c A T 13: 32,896,990 S37T probably benign Het
Snx19 A G 9: 30,428,343 D259G probably damaging Het
Sorcs3 A G 19: 48,764,181 K805R probably damaging Het
Sox6 C A 7: 115,777,123 G125W probably damaging Het
Spink5 A G 18: 43,967,107 I64V probably benign Het
St6galnac1 A G 11: 116,766,648 probably benign Het
Sult1c2 T C 17: 53,836,963 I105V probably benign Het
Tacr3 T G 3: 134,829,756 S162A probably damaging Het
Tex43 T A 18: 56,594,534 D101E probably benign Het
Ttc6 T C 12: 57,674,763 S1013P probably damaging Het
Zbtb11 C A 16: 55,990,815 N445K probably benign Het
Zfp423 A C 8: 87,782,558 V261G probably benign Het
Zfp59 T C 7: 27,853,591 V156A probably benign Het
Zscan2 C A 7: 80,863,393 A42E probably damaging Het
Other mutations in Cdhr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02097:Cdhr5 APN 7 141269981 missense probably damaging 0.99
IGL02662:Cdhr5 APN 7 141274503 missense possibly damaging 0.57
R0002:Cdhr5 UTSW 7 141270020 splice site probably null
R0098:Cdhr5 UTSW 7 141269868 missense probably damaging 1.00
R0201:Cdhr5 UTSW 7 141276378 missense probably damaging 1.00
R0494:Cdhr5 UTSW 7 141272518 missense probably damaging 1.00
R0508:Cdhr5 UTSW 7 141272899 missense probably benign 0.41
R0918:Cdhr5 UTSW 7 141272149 missense probably damaging 1.00
R1571:Cdhr5 UTSW 7 141272170 missense probably damaging 1.00
R1838:Cdhr5 UTSW 7 141272603 missense possibly damaging 0.93
R3912:Cdhr5 UTSW 7 141273857 missense probably damaging 1.00
R4289:Cdhr5 UTSW 7 141272839 missense probably damaging 0.99
R4491:Cdhr5 UTSW 7 141274057 missense possibly damaging 0.55
R4838:Cdhr5 UTSW 7 141273731 missense probably damaging 1.00
R4949:Cdhr5 UTSW 7 141272644 missense probably damaging 0.97
R5187:Cdhr5 UTSW 7 141274448 missense probably damaging 1.00
R5344:Cdhr5 UTSW 7 141276524 missense probably damaging 0.97
R5642:Cdhr5 UTSW 7 141269197 nonsense probably null
R6736:Cdhr5 UTSW 7 141272531 missense probably damaging 0.97
R7172:Cdhr5 UTSW 7 141271928 missense possibly damaging 0.90
R7212:Cdhr5 UTSW 7 141272659 missense probably damaging 0.99
R7693:Cdhr5 UTSW 7 141271778 missense probably benign
RF016:Cdhr5 UTSW 7 141272184 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGACAGTGAATCCAGGGCAATGTG -3'
(R):5'- GGAACGACTGGGCCTTCAAGTAAC -3'

Sequencing Primer
(F):5'- TGGACTACCTGAGATGGGC -3'
(R):5'- CACTATGGAAGCCCCCTTG -3'
Posted On2014-04-24