Mutagenetix > Incidental Mutations

Incidental Mutation 'R1570:Snx19'

177190

Institutional Source

Beutler Lab

Gene Symbol

Snx19

Ensembl Gene

ENSMUSG00000031993

Gene Name

sorting nexin 19

Synonyms

3526401K03Rik

MMRRC Submission

039609-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R1570 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30427108-30466733 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30428343 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 259 (D259G)

Ref Sequence

ENSEMBL: ENSMUSP00000131895 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164099]

Predicted Effect

probably damaging
Transcript: ENSMUST00000164099
AA Change: D259G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000131895
Gene: ENSMUSG00000031993
AA Change: D259G

Domain	Start	End	E-Value	Type
transmembrane domain	29	46	N/A	INTRINSIC
transmembrane domain	51	73	N/A	INTRINSIC
Pfam:PXA	96	269	2.9e-43	PFAM
low complexity region	324	335	N/A	INTRINSIC
low complexity region	371	385	N/A	INTRINSIC
low complexity region	504	528	N/A	INTRINSIC
PX	533	664	1.83e-24	SMART
Pfam:Nexin_C	843	951	1.9e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216552

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217174

Meta Mutation Damage Score

0.8855

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.0%

Validation Efficiency

93% (77/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Islet antigen-2 (IA-2) is an autoantigen in type 1 diabetes and plays a role in insulin secretion. IA-2 is found in dense-core secretory vesicles and interacts with the product of this gene, a sorting nexin. In mouse pancreatic beta-cells, the encoded protein influenced insulin secretion by stabilizing the number of dense-core secretory vesicles. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apobec1	A	G	6: 122,591,085		probably null	Het
Arhgap21	G	T	2: 20,880,840	Q348K	probably benign	Het
Arl5c	A	G	11: 97,992,387	V129A	probably benign	Het
Armh1	A	G	4: 117,229,992	S159P	probably damaging	Het
Asb8	A	G	15: 98,136,428	L82P	probably damaging	Het
Bahcc1	G	A	11: 120,272,183	A436T	possibly damaging	Het
Btc	T	C	5: 91,402,717	D2G	unknown	Het
C1s2	G	A	6: 124,625,764	T490M	probably benign	Het
Caap1	C	T	4: 94,556,577	G43D	probably benign	Het
Ccr5	T	C	9: 124,124,963	V201A	probably benign	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Cdhr5	C	A	7: 141,271,769	G541C	probably damaging	Het
Cep170	A	G	1: 176,755,801	I1004T	possibly damaging	Het
Chd9	A	T	8: 91,036,542	M2332L	probably benign	Het
Clk1	T	A	1: 58,414,425	H334L	probably benign	Het
Cyp4b1	G	A	4: 115,635,963	S228F	probably benign	Het
Dnah9	T	C	11: 66,112,330	N883D	probably benign	Het
Dync2h1	A	G	9: 7,176,926	L11P	probably benign	Het
Ephx4	A	G	5: 107,419,851	E225G	probably damaging	Het
Erich6	C	T	3: 58,630,659		probably null	Het
Espl1	A	G	15: 102,298,367	T89A	probably damaging	Het
Evi2	T	A	11: 79,516,250	K166N	possibly damaging	Het
Glrx5	A	G	12: 105,032,868	T57A	possibly damaging	Het
Gm15448	T	C	7: 3,823,061	E311G	probably benign	Het
Gm884	A	G	11: 103,609,938	Y597H	possibly damaging	Het
Gnptab	T	A	10: 88,419,454	V222E	probably damaging	Het
Gpr155	T	C	2: 73,370,038	Y375C	possibly damaging	Het
Hsd11b1	C	G	1: 193,240,327	E141Q	probably damaging	Het
Ildr2	T	C	1: 166,303,585	F337L	probably damaging	Het
Ino80	C	T	2: 119,447,028	R322Q	possibly damaging	Het
Lcp2	A	G	11: 34,089,601	D467G	probably benign	Het
Lmbr1	A	G	5: 29,254,558	I229T	probably damaging	Het
Lnpep	A	T	17: 17,579,156	M79K	probably damaging	Het
Lpin1	T	C	12: 16,560,998	Q564R	possibly damaging	Het
Lpin2	T	A	17: 71,245,181	L794*	probably null	Het
Lrrc45	T	C	11: 120,720,109		probably null	Het
Mtus1	A	G	8: 41,076,241	S751P	probably damaging	Het
Nbr1	T	C	11: 101,564,830		probably benign	Het
Nup107	A	G	10: 117,763,844	F592S	possibly damaging	Het
Nup133	T	A	8: 123,949,176	M1L	possibly damaging	Het
Olfr1104	A	T	2: 87,022,272	S91T	probably benign	Het
Olfr1208	A	C	2: 88,896,946	I217S	probably damaging	Het
Olfr139	A	C	11: 74,044,807	F156V	possibly damaging	Het
Olfr434	T	C	6: 43,217,351	V146A	probably benign	Het
Olfr548-ps1	C	A	7: 102,541,970	H11Q	probably damaging	Het
Olfr732	T	G	14: 50,281,524	H243P	probably damaging	Het
Otud7b	T	C	3: 96,155,891	C816R	probably damaging	Het
Pi4k2a	T	C	19: 42,100,644	V148A	probably benign	Het
Pih1d2	T	C	9: 50,621,179	M195T	probably benign	Het
Plpp6	T	C	19: 28,964,778	F260L	probably damaging	Het
R3hcc1l	A	T	19: 42,581,954	T663S	probably damaging	Het
Rnf25	T	C	1: 74,595,267	E199G	probably damaging	Het
Scin	G	A	12: 40,084,381		probably benign	Het
Serpinb1c	A	T	13: 32,896,990	S37T	probably benign	Het
Sorcs3	A	G	19: 48,764,181	K805R	probably damaging	Het
Sox6	C	A	7: 115,777,123	G125W	probably damaging	Het
Spink5	A	G	18: 43,967,107	I64V	probably benign	Het
St6galnac1	A	G	11: 116,766,648		probably benign	Het
Sult1c2	T	C	17: 53,836,963	I105V	probably benign	Het
Tacr3	T	G	3: 134,829,756	S162A	probably damaging	Het
Tex43	T	A	18: 56,594,534	D101E	probably benign	Het
Ttc6	T	C	12: 57,674,763	S1013P	probably damaging	Het
Zbtb11	C	A	16: 55,990,815	N445K	probably benign	Het
Zfp423	A	C	8: 87,782,558	V261G	probably benign	Het
Zfp59	T	C	7: 27,853,591	V156A	probably benign	Het
Zscan2	C	A	7: 80,863,393	A42E	probably damaging	Het

Other mutations in Snx19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Snx19	APN	9	30429084	missense	possibly damaging	0.92
IGL00498:Snx19	APN	9	30428937	missense	possibly damaging	0.92
IGL00718:Snx19	APN	9	30432326	missense	probably damaging	1.00
IGL00902:Snx19	APN	9	30428732	missense	possibly damaging	0.90
IGL01433:Snx19	APN	9	30428771	missense	possibly damaging	0.93
IGL01668:Snx19	APN	9	30427823	missense	probably benign
IGL01732:Snx19	APN	9	30462353	missense	probably damaging	1.00
IGL01767:Snx19	APN	9	30463264	missense	possibly damaging	0.95
IGL02638:Snx19	APN	9	30432364	missense	possibly damaging	0.52
IGL02718:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02719:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02723:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02724:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02725:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02892:Snx19	APN	9	30428364	missense	probably damaging	1.00
IGL03061:Snx19	APN	9	30433632	missense	probably damaging	0.99
IGL03402:Snx19	APN	9	30440134	missense	possibly damaging	0.89
R0125:Snx19	UTSW	9	30440219	missense	probably damaging	1.00
R0133:Snx19	UTSW	9	30428616	missense	possibly damaging	0.94
R0196:Snx19	UTSW	9	30433387	missense	probably damaging	1.00
R0423:Snx19	UTSW	9	30435837	missense	probably damaging	1.00
R0635:Snx19	UTSW	9	30428810	missense	probably damaging	1.00
R0635:Snx19	UTSW	9	30428811	missense	probably damaging	1.00
R1068:Snx19	UTSW	9	30429018	missense	probably damaging	0.99
R1727:Snx19	UTSW	9	30433366	missense	probably damaging	1.00
R1895:Snx19	UTSW	9	30432324	missense	probably damaging	1.00
R1907:Snx19	UTSW	9	30433576	missense	probably damaging	0.99
R1946:Snx19	UTSW	9	30432324	missense	probably damaging	1.00
R1989:Snx19	UTSW	9	30428108	missense	possibly damaging	0.93
R2029:Snx19	UTSW	9	30429000	missense	probably benign	0.01
R2914:Snx19	UTSW	9	30433532	unclassified	probably benign
R3880:Snx19	UTSW	9	30462392	missense	probably damaging	1.00
R4223:Snx19	UTSW	9	30428448	missense	possibly damaging	0.95
R4415:Snx19	UTSW	9	30437483	missense	probably damaging	0.99
R4438:Snx19	UTSW	9	30428599	missense	probably benign	0.01
R4484:Snx19	UTSW	9	30427896	missense	probably benign	0.01
R4585:Snx19	UTSW	9	30440195	missense	probably damaging	1.00
R4765:Snx19	UTSW	9	30440157	missense	probably damaging	1.00
R4771:Snx19	UTSW	9	30433638	missense	probably damaging	1.00
R4922:Snx19	UTSW	9	30437467	missense	probably benign	0.25
R5096:Snx19	UTSW	9	30428786	missense	probably benign	0.40
R5464:Snx19	UTSW	9	30427973	missense	possibly damaging	0.54
R6469:Snx19	UTSW	9	30427743	missense	possibly damaging	0.50
R6886:Snx19	UTSW	9	30428935	missense	probably damaging	1.00
R6988:Snx19	UTSW	9	30428935	missense	probably damaging	1.00
R7131:Snx19	UTSW	9	30427893	missense	probably damaging	1.00
R7268:Snx19	UTSW	9	30440177	missense	probably damaging	1.00
R7772:Snx19	UTSW	9	30428925	missense	probably damaging	0.99
R8087:Snx19	UTSW	9	30464402	missense	probably benign
R8211:Snx19	UTSW	9	30437465	missense	probably benign
R8283:Snx19	UTSW	9	30463226	missense	possibly damaging	0.56
X0019:Snx19	UTSW	9	30437366	missense	probably damaging	1.00
X0024:Snx19	UTSW	9	30427721	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GATGCTTACTGCCAGGTTACAGCTC -3'
(R):5'- CAGGCAAATCTCCCTCTACAGCTTC -3'

Sequencing Primer
(F):5'- CAGGTTACAGCTCCCCATC -3'
(R):5'- TGGCTCACTGGAGGTCAAG -3'

Posted On

2014-04-24