Mutagenetix > Incidental Mutations

Incidental Mutation 'R1570:Cd109'

177193

Institutional Source

Beutler Lab

Gene Symbol

Cd109

Ensembl Gene

ENSMUSG00000046186

Gene Name

CD109 antigen

Synonyms

Gov platelet alloantigens, 9930012E15Rik

MMRRC Submission

039609-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1570 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

78615546-78716253 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT at 78712500 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000091330 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093812]

Predicted Effect

probably benign
Transcript: ENSMUST00000093812

SMART Domains

Protein: ENSMUSP00000091330
Gene: ENSMUSG00000046186

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:A2M_N	129	220	1.5e-16	PFAM
A2M_N_2	470	601	8.89e-32	SMART
A2M	695	786	2.07e-32	SMART
Pfam:Thiol-ester_cl	912	941	2.6e-20	PFAM
Pfam:A2M_comp	961	1197	1.9e-65	PFAM
low complexity region	1265	1275	N/A	INTRINSIC
A2M_recep	1311	1395	2.06e-27	SMART
low complexity region	1422	1437	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.0%

Validation Efficiency

93% (77/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl phosphatidylinositol (GPI)-linked glycoprotein that localizes to the surface of platelets, activated T-cells, and endothelial cells. The protein binds to and negatively regulates signalling by transforming growth factor beta (TGF-beta). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a null mutation display epidermal hyperplasia and thickening, sebaceous gland hyperplasia and transient impairment of hair growth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apobec1	A	G	6: 122,591,085		probably null	Het
Arhgap21	G	T	2: 20,880,840	Q348K	probably benign	Het
Arl5c	A	G	11: 97,992,387	V129A	probably benign	Het
Armh1	A	G	4: 117,229,992	S159P	probably damaging	Het
Asb8	A	G	15: 98,136,428	L82P	probably damaging	Het
Bahcc1	G	A	11: 120,272,183	A436T	possibly damaging	Het
Btc	T	C	5: 91,402,717	D2G	unknown	Het
C1s2	G	A	6: 124,625,764	T490M	probably benign	Het
Caap1	C	T	4: 94,556,577	G43D	probably benign	Het
Ccr5	T	C	9: 124,124,963	V201A	probably benign	Het
Cdhr5	C	A	7: 141,271,769	G541C	probably damaging	Het
Cep170	A	G	1: 176,755,801	I1004T	possibly damaging	Het
Chd9	A	T	8: 91,036,542	M2332L	probably benign	Het
Clk1	T	A	1: 58,414,425	H334L	probably benign	Het
Cyp4b1	G	A	4: 115,635,963	S228F	probably benign	Het
Dnah9	T	C	11: 66,112,330	N883D	probably benign	Het
Dync2h1	A	G	9: 7,176,926	L11P	probably benign	Het
Ephx4	A	G	5: 107,419,851	E225G	probably damaging	Het
Erich6	C	T	3: 58,630,659		probably null	Het
Espl1	A	G	15: 102,298,367	T89A	probably damaging	Het
Evi2	T	A	11: 79,516,250	K166N	possibly damaging	Het
Glrx5	A	G	12: 105,032,868	T57A	possibly damaging	Het
Gm15448	T	C	7: 3,823,061	E311G	probably benign	Het
Gm884	A	G	11: 103,609,938	Y597H	possibly damaging	Het
Gnptab	T	A	10: 88,419,454	V222E	probably damaging	Het
Gpr155	T	C	2: 73,370,038	Y375C	possibly damaging	Het
Hsd11b1	C	G	1: 193,240,327	E141Q	probably damaging	Het
Ildr2	T	C	1: 166,303,585	F337L	probably damaging	Het
Ino80	C	T	2: 119,447,028	R322Q	possibly damaging	Het
Lcp2	A	G	11: 34,089,601	D467G	probably benign	Het
Lmbr1	A	G	5: 29,254,558	I229T	probably damaging	Het
Lnpep	A	T	17: 17,579,156	M79K	probably damaging	Het
Lpin1	T	C	12: 16,560,998	Q564R	possibly damaging	Het
Lpin2	T	A	17: 71,245,181	L794*	probably null	Het
Lrrc45	T	C	11: 120,720,109		probably null	Het
Mtus1	A	G	8: 41,076,241	S751P	probably damaging	Het
Nbr1	T	C	11: 101,564,830		probably benign	Het
Nup107	A	G	10: 117,763,844	F592S	possibly damaging	Het
Nup133	T	A	8: 123,949,176	M1L	possibly damaging	Het
Olfr1104	A	T	2: 87,022,272	S91T	probably benign	Het
Olfr1208	A	C	2: 88,896,946	I217S	probably damaging	Het
Olfr139	A	C	11: 74,044,807	F156V	possibly damaging	Het
Olfr434	T	C	6: 43,217,351	V146A	probably benign	Het
Olfr548-ps1	C	A	7: 102,541,970	H11Q	probably damaging	Het
Olfr732	T	G	14: 50,281,524	H243P	probably damaging	Het
Otud7b	T	C	3: 96,155,891	C816R	probably damaging	Het
Pi4k2a	T	C	19: 42,100,644	V148A	probably benign	Het
Pih1d2	T	C	9: 50,621,179	M195T	probably benign	Het
Plpp6	T	C	19: 28,964,778	F260L	probably damaging	Het
R3hcc1l	A	T	19: 42,581,954	T663S	probably damaging	Het
Rnf25	T	C	1: 74,595,267	E199G	probably damaging	Het
Scin	G	A	12: 40,084,381		probably benign	Het
Serpinb1c	A	T	13: 32,896,990	S37T	probably benign	Het
Snx19	A	G	9: 30,428,343	D259G	probably damaging	Het
Sorcs3	A	G	19: 48,764,181	K805R	probably damaging	Het
Sox6	C	A	7: 115,777,123	G125W	probably damaging	Het
Spink5	A	G	18: 43,967,107	I64V	probably benign	Het
St6galnac1	A	G	11: 116,766,648		probably benign	Het
Sult1c2	T	C	17: 53,836,963	I105V	probably benign	Het
Tacr3	T	G	3: 134,829,756	S162A	probably damaging	Het
Tex43	T	A	18: 56,594,534	D101E	probably benign	Het
Ttc6	T	C	12: 57,674,763	S1013P	probably damaging	Het
Zbtb11	C	A	16: 55,990,815	N445K	probably benign	Het
Zfp423	A	C	8: 87,782,558	V261G	probably benign	Het
Zfp59	T	C	7: 27,853,591	V156A	probably benign	Het
Zscan2	C	A	7: 80,863,393	A42E	probably damaging	Het

Other mutations in Cd109

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Cd109	APN	9	78616969	missense	probably damaging	1.00
IGL00465:Cd109	APN	9	78660934	nonsense	probably null
IGL00667:Cd109	APN	9	78684877	missense	probably damaging	0.99
IGL01432:Cd109	APN	9	78698123	missense	probably benign
IGL01795:Cd109	APN	9	78661765	splice site	probably benign
IGL02343:Cd109	APN	9	78688955	splice site	probably benign
IGL02450:Cd109	APN	9	78695850	missense	possibly damaging	0.83
IGL02699:Cd109	APN	9	78671989	splice site	probably benign
IGL02738:Cd109	APN	9	78691299	missense	probably damaging	1.00
IGL02797:Cd109	APN	9	78661713	missense	probably damaging	0.96
IGL03160:Cd109	APN	9	78661056	splice site	probably null
IGL03349:Cd109	APN	9	78636485	missense	probably benign	0.34
FR4589:Cd109	UTSW	9	78712529	critical splice acceptor site	probably benign
R0048:Cd109	UTSW	9	78680021	missense	possibly damaging	0.50
R0060:Cd109	UTSW	9	78703107	missense	probably damaging	1.00
R0060:Cd109	UTSW	9	78703107	missense	probably damaging	1.00
R0158:Cd109	UTSW	9	78688932	missense	possibly damaging	0.49
R0415:Cd109	UTSW	9	78712615	missense	probably benign	0.13
R0659:Cd109	UTSW	9	78680170	splice site	probably benign
R0709:Cd109	UTSW	9	78671978	missense	possibly damaging	0.93
R0840:Cd109	UTSW	9	78664330	missense	probably benign	0.04
R0909:Cd109	UTSW	9	78636473	missense	probably benign	0.01
R0945:Cd109	UTSW	9	78688941	missense	possibly damaging	0.51
R1344:Cd109	UTSW	9	78672550	critical splice acceptor site	probably null
R1471:Cd109	UTSW	9	78654587	missense	probably damaging	1.00
R1484:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R1688:Cd109	UTSW	9	78705091	missense	probably benign	0.17
R1773:Cd109	UTSW	9	78703724	missense	probably benign	0.21
R1813:Cd109	UTSW	9	78617005	missense	probably benign	0.04
R2004:Cd109	UTSW	9	78703762	missense	probably benign	0.00
R2083:Cd109	UTSW	9	78667293	missense	probably damaging	1.00
R2483:Cd109	UTSW	9	78667357	missense	probably damaging	1.00
R2857:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2858:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2859:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2911:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2912:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2914:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2927:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3623:Cd109	UTSW	9	78667357	missense	probably damaging	1.00
R3713:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3760:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3762:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3771:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3772:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3773:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3916:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3917:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4117:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4260:Cd109	UTSW	9	78636463	missense	possibly damaging	0.67
R4387:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4389:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4526:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4527:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4528:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4700:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4708:Cd109	UTSW	9	78672589	missense	probably benign	0.00
R4723:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4750:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4751:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4754:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4755:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4773:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4984:Cd109	UTSW	9	78634677	critical splice donor site	probably null
R5259:Cd109	UTSW	9	78710152	missense	probably benign	0.30
R5353:Cd109	UTSW	9	78710239	missense	probably damaging	1.00
R5440:Cd109	UTSW	9	78680164	critical splice donor site	probably null
R5559:Cd109	UTSW	9	78660968	missense	probably benign	0.01
R5701:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R5995:Cd109	UTSW	9	78700279	missense	probably benign	0.01
R5997:Cd109	UTSW	9	78705062	missense	possibly damaging	0.93
R6103:Cd109	UTSW	9	78698314	splice site	probably null
R6174:Cd109	UTSW	9	78665546	critical splice donor site	probably null
R6410:Cd109	UTSW	9	78657516	missense	probably benign	0.01
R6529:Cd109	UTSW	9	78712625	missense	probably damaging	1.00
R6655:Cd109	UTSW	9	78684938	missense	probably benign	0.44
R6704:Cd109	UTSW	9	78680075	missense	probably benign	0.01
R6772:Cd109	UTSW	9	78680810	missense	possibly damaging	0.55
R6817:Cd109	UTSW	9	78714955	missense	probably benign	0.01
R6903:Cd109	UTSW	9	78636603	missense	probably damaging	0.97
R7294:Cd109	UTSW	9	78712635	missense	probably damaging	0.97
R7432:Cd109	UTSW	9	78714943	missense	possibly damaging	0.85
R7566:Cd109	UTSW	9	78680837	missense	probably damaging	1.00
R7767:Cd109	UTSW	9	78710159	missense	probably damaging	1.00
RF002:Cd109	UTSW	9	78712523	critical splice acceptor site	probably benign
RF002:Cd109	UTSW	9	78712528	critical splice acceptor site	probably benign
RF003:Cd109	UTSW	9	78712531	critical splice acceptor site	probably benign
RF011:Cd109	UTSW	9	78712528	critical splice acceptor site	probably benign
RF013:Cd109	UTSW	9	78712531	critical splice acceptor site	probably benign
RF047:Cd109	UTSW	9	78712527	critical splice acceptor site	probably benign
RF060:Cd109	UTSW	9	78712525	critical splice acceptor site	probably benign

Predicted Primers

PCR Primer
(F):5'- AGCATCCCTTTAGTAGACGGGGAC -3'
(R):5'- TCTTCATTTACAGACAGCCTGCCAC -3'

Sequencing Primer
(F):5'- actaagaaccattcctctgctatc -3'
(R):5'- GAGTAAAATGCCTGCCTTGATTCC -3'

Posted On

2014-04-24