Incidental Mutation 'R1583:Slc9a4'
ID177227
Institutional Source Beutler Lab
Gene Symbol Slc9a4
Ensembl Gene ENSMUSG00000026065
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 4
SynonymsD730009J23Rik, NHE4
MMRRC Submission 039620-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1583 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location40580081-40630725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40600962 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 305 (I305F)
Ref Sequence ENSEMBL: ENSMUSP00000027233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027233]
Predicted Effect probably benign
Transcript: ENSMUST00000027233
AA Change: I305F

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000027233
Gene: ENSMUSG00000026065
AA Change: I305F

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_H_Exchanger 73 477 1.6e-90 PFAM
PDB:2E30|B 481 516 9e-8 PDB
Pfam:NEXCaM_BD 566 675 8.1e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193371
Meta Mutation Damage Score 0.1059 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 99% (79/80)
MGI Phenotype PHENOTYPE: Homozygous null mice display normal growth and survival but have gastric secretions with reduced acidity, mild gastric necrosis and apoptosis, and abnormal gastric mucosa with reduced numbers of parietal and chief cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,882,681 S691P probably benign Het
Adgrb3 T C 1: 25,226,831 probably null Het
Ankar A G 1: 72,679,555 probably benign Het
Aplf A T 6: 87,646,033 Y355N probably damaging Het
Bms1 A G 6: 118,389,389 probably benign Het
Catsperb T C 12: 101,463,114 I182T probably damaging Het
Cd300ld2 T C 11: 115,013,777 D88G probably benign Het
Cebpz T C 17: 78,934,752 N491S probably damaging Het
Crybg2 T C 4: 134,081,459 S1415P probably damaging Het
Ddc A G 11: 11,829,131 V331A probably benign Het
Decr2 T C 17: 26,083,024 E244G probably damaging Het
Dhrs11 A G 11: 84,823,117 M136T probably damaging Het
Eapp G A 12: 54,685,948 Q126* probably null Het
Fam111a T A 19: 12,587,778 V297D probably damaging Het
Fam84a G A 12: 14,150,408 A106V probably benign Het
Fbxo10 A C 4: 45,062,118 L136R probably damaging Het
Fbxo30 T A 10: 11,291,374 H613Q possibly damaging Het
Frk A T 10: 34,591,810 probably null Het
Gm10392 T A 11: 77,517,481 D104V probably benign Het
Gm960 T A 19: 4,652,171 K282N probably damaging Het
Gpn1 A G 5: 31,497,338 E78G possibly damaging Het
Hhip T C 8: 79,990,276 Y506C probably damaging Het
Hid1 G A 11: 115,356,750 S274L possibly damaging Het
Immp2l G T 12: 41,703,765 probably benign Het
Klhl21 T C 4: 152,009,624 F228L possibly damaging Het
Lamc1 T A 1: 153,243,478 probably null Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Magi2 T C 5: 19,227,332 V15A probably benign Het
Map2k7 T C 8: 4,243,621 probably null Het
Mga T A 2: 119,963,960 H2590Q possibly damaging Het
Mlxip T C 5: 123,450,223 I238T possibly damaging Het
Mylk T A 16: 34,875,586 D230E probably benign Het
Nacad T A 11: 6,601,185 T669S probably benign Het
Nin C T 12: 70,031,738 M1691I probably benign Het
Nlrp4d C T 7: 10,382,237 A203T probably damaging Het
Olfr1204 T G 2: 88,852,262 F104C probably damaging Het
Olfr1301 A T 2: 111,754,425 M59L probably damaging Het
Olfr1495 A T 19: 13,768,510 H56L probably benign Het
Olfr201 A G 16: 59,269,031 V212A probably benign Het
Olfr433 T C 1: 174,042,480 F177L probably benign Het
Olfr729 C A 14: 50,148,774 M33I probably benign Het
Osbp C A 19: 11,977,829 Q282K probably benign Het
Osbpl2 A G 2: 180,148,463 S177G probably damaging Het
Pax1 A G 2: 147,366,255 H261R possibly damaging Het
Pcif1 A T 2: 164,886,727 L274F probably damaging Het
Pkhd1 A G 1: 20,117,825 S3420P probably benign Het
Prss3 A C 6: 41,377,627 probably benign Het
Ptk2b T C 14: 66,163,114 T751A possibly damaging Het
Pus10 T C 11: 23,673,239 V126A probably damaging Het
Rai14 A C 15: 10,587,916 D258E probably damaging Het
Rbp3 T C 14: 33,954,524 V143A possibly damaging Het
Sarm1 G A 11: 78,483,327 Q625* probably null Het
Scgb1b21 T G 7: 33,527,667 noncoding transcript Het
Scrn1 A T 6: 54,520,769 V279E probably damaging Het
Sipa1l2 T C 8: 125,421,895 T1670A probably damaging Het
Smarcc1 A G 9: 110,213,617 T918A probably damaging Het
Tas2r109 A T 6: 132,980,426 H180Q probably benign Het
Tas2r121 G A 6: 132,700,230 R260* probably null Het
Tenm3 T C 8: 48,279,074 D1249G probably benign Het
Tgtp1 C G 11: 48,987,530 G116A probably damaging Het
Tial1 A G 7: 128,443,910 Y317H probably damaging Het
Trim66 A T 7: 109,455,080 W1308R probably damaging Het
Ulk2 T G 11: 61,783,545 K878N possibly damaging Het
Zfp41 T A 15: 75,618,291 S31T possibly damaging Het
Other mutations in Slc9a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Slc9a4 APN 1 40629405 missense probably benign 0.01
IGL01802:Slc9a4 APN 1 40607798 missense probably damaging 1.00
IGL01909:Slc9a4 APN 1 40612291 splice site probably benign
IGL02137:Slc9a4 APN 1 40600899 missense possibly damaging 0.79
IGL02399:Slc9a4 APN 1 40600782 missense probably benign 0.00
IGL02685:Slc9a4 APN 1 40629582 missense probably benign
IGL02874:Slc9a4 APN 1 40584038 missense probably benign 0.02
IGL02892:Slc9a4 APN 1 40584044 missense possibly damaging 0.64
IGL03028:Slc9a4 APN 1 40610377 missense probably benign 0.06
IGL03083:Slc9a4 APN 1 40629402 missense probably benign 0.00
IGL03124:Slc9a4 APN 1 40580735 missense probably damaging 0.99
IGL03144:Slc9a4 APN 1 40612202 missense probably damaging 1.00
IGL03286:Slc9a4 APN 1 40580768 missense probably null 0.99
R0601:Slc9a4 UTSW 1 40603070 missense probably damaging 1.00
R1118:Slc9a4 UTSW 1 40584330 splice site probably benign
R1752:Slc9a4 UTSW 1 40629261 missense probably benign 0.00
R1776:Slc9a4 UTSW 1 40629287 missense probably benign 0.00
R1785:Slc9a4 UTSW 1 40607741 splice site probably null
R1786:Slc9a4 UTSW 1 40607741 splice site probably null
R2131:Slc9a4 UTSW 1 40607741 splice site probably null
R2132:Slc9a4 UTSW 1 40607741 splice site probably null
R2133:Slc9a4 UTSW 1 40607741 splice site probably null
R3785:Slc9a4 UTSW 1 40583970 missense probably damaging 1.00
R4223:Slc9a4 UTSW 1 40619126 missense probably damaging 0.98
R4567:Slc9a4 UTSW 1 40580577 missense probably damaging 0.99
R4605:Slc9a4 UTSW 1 40601035 splice site probably null
R4641:Slc9a4 UTSW 1 40607125 missense probably damaging 1.00
R5407:Slc9a4 UTSW 1 40607794 missense probably benign 0.41
R5823:Slc9a4 UTSW 1 40619117 missense probably damaging 0.97
R5877:Slc9a4 UTSW 1 40612263 missense probably benign
R6389:Slc9a4 UTSW 1 40580684 missense probably benign 0.00
R6430:Slc9a4 UTSW 1 40600854 nonsense probably null
R6603:Slc9a4 UTSW 1 40623504 missense probably benign 0.43
R6950:Slc9a4 UTSW 1 40602885 missense probably damaging 1.00
R7102:Slc9a4 UTSW 1 40580639 missense probably benign 0.00
R7102:Slc9a4 UTSW 1 40623399 missense probably damaging 1.00
R7230:Slc9a4 UTSW 1 40600771 missense probably damaging 1.00
R7313:Slc9a4 UTSW 1 40629503 missense probably benign 0.28
R7384:Slc9a4 UTSW 1 40612251 missense probably benign 0.10
R7405:Slc9a4 UTSW 1 40600926 missense probably damaging 1.00
R7770:Slc9a4 UTSW 1 40600963 missense probably damaging 0.98
R7784:Slc9a4 UTSW 1 40600776 missense probably damaging 1.00
R8313:Slc9a4 UTSW 1 40580360 start gained probably benign
R8724:Slc9a4 UTSW 1 40584141 missense probably damaging 0.98
X0060:Slc9a4 UTSW 1 40619031 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGTTAATCTCTGTGCCGTTGACTCG -3'
(R):5'- GGCAAAGGACCAGGTTCAGCTTTC -3'

Sequencing Primer
(F):5'- GTGAAGTCAAGAATCCATGTGTAAC -3'
(R):5'- GAAATTCTAAACCTTCCAGTGCCTC -3'
Posted On2014-04-24