Mutagenetix > Incidental Mutation

Incidental Mutation 'R1583:Lamc1'

177229

Institutional Source

Beutler Lab

Gene Symbol

Lamc1

Ensembl Gene

ENSMUSG00000026478

Gene Name

laminin, gamma 1

Synonyms

laminin B2, Lamb2

MMRRC Submission

039620-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1583 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

153218922-153332786 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to A at 153243478 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000027752 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027752] [ENSMUST00000027752]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000027752

SMART Domains

Protein: ENSMUSP00000027752
Gene: ENSMUSG00000026478

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
LamNT	42	282	1.97e-150	SMART
EGF_Lam	284	337	7.18e-7	SMART
EGF_Lam	340	393	7.93e-9	SMART
EGF_Lam	396	440	2.11e-13	SMART
EGF_Lam	443	490	2.87e-15	SMART
LamB	551	676	5.52e-48	SMART
Pfam:Laminin_EGF	683	718	1.3e-4	PFAM
EGF_Lam	722	768	2.38e-12	SMART
EGF_Lam	771	823	1.39e-4	SMART
EGF_Lam	826	879	8.05e-10	SMART
EGF_Lam	882	930	8.9e-12	SMART
EGF_Lam	933	978	1.26e-11	SMART
EGF_Lam	981	1026	7.4e-9	SMART
coiled coil region	1063	1594	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000027752

SMART Domains

Protein: ENSMUSP00000027752
Gene: ENSMUSG00000026478

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
LamNT	42	282	1.97e-150	SMART
EGF_Lam	284	337	7.18e-7	SMART
EGF_Lam	340	393	7.93e-9	SMART
EGF_Lam	396	440	2.11e-13	SMART
EGF_Lam	443	490	2.87e-15	SMART
LamB	551	676	5.52e-48	SMART
Pfam:Laminin_EGF	683	718	1.3e-4	PFAM
EGF_Lam	722	768	2.38e-12	SMART
EGF_Lam	771	823	1.39e-4	SMART
EGF_Lam	826	879	8.05e-10	SMART
EGF_Lam	882	930	8.9e-12	SMART
EGF_Lam	933	978	1.26e-11	SMART
EGF_Lam	981	1026	7.4e-9	SMART
coiled coil region	1063	1594	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163011

SMART Domains

Protein: ENSMUSP00000124216
Gene: ENSMUSG00000026478

Domain	Start	End	E-Value	Type
coiled coil region	1	93	N/A	INTRINSIC

Meta Mutation Damage Score

0.9591

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.2%
20x: 88.8%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 1. The gamma 1 chain, formerly thought to be a beta chain, contains structural domains similar to beta chains, however, lacks the short alpha region separating domains I and II. The structural organization of this gene also suggested that it had diverged considerably from the beta chain genes. Embryos of transgenic mice in which both alleles of the gamma 1 chain gene were inactivated by homologous recombination, lacked basement membranes, indicating that laminin, gamma 1 chain is necessary for laminin heterotrimer assembly. It has been inferred by analogy with the strikingly similar 3' UTR sequence in mouse laminin gamma 1 cDNA, that multiple polyadenylation sites are utilized in human to generate the 2 different sized mRNAs (5.5 and 7.5 kb) seen on Northern analysis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a targeted null mutation lack development of basement membranes, migration of primitive endoderm cells out of the inner cell mass, and parietal yolk sac development, resulting in lethality by embryonic day 5.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	G	5: 76,882,681	S691P	probably benign	Het
Adgrb3	T	C	1: 25,226,831		probably null	Het
Ankar	A	G	1: 72,679,555		probably benign	Het
Aplf	A	T	6: 87,646,033	Y355N	probably damaging	Het
Bms1	A	G	6: 118,389,389		probably benign	Het
Catsperb	T	C	12: 101,463,114	I182T	probably damaging	Het
Cd300ld2	T	C	11: 115,013,777	D88G	probably benign	Het
Cebpz	T	C	17: 78,934,752	N491S	probably damaging	Het
Crybg2	T	C	4: 134,081,459	S1415P	probably damaging	Het
Ddc	A	G	11: 11,829,131	V331A	probably benign	Het
Decr2	T	C	17: 26,083,024	E244G	probably damaging	Het
Dhrs11	A	G	11: 84,823,117	M136T	probably damaging	Het
Eapp	G	A	12: 54,685,948	Q126*	probably null	Het
Fam111a	T	A	19: 12,587,778	V297D	probably damaging	Het
Fam84a	G	A	12: 14,150,408	A106V	probably benign	Het
Fbxo10	A	C	4: 45,062,118	L136R	probably damaging	Het
Fbxo30	T	A	10: 11,291,374	H613Q	possibly damaging	Het
Frk	A	T	10: 34,591,810		probably null	Het
Gm10392	T	A	11: 77,517,481	D104V	probably benign	Het
Gm960	T	A	19: 4,652,171	K282N	probably damaging	Het
Gpn1	A	G	5: 31,497,338	E78G	possibly damaging	Het
Hhip	T	C	8: 79,990,276	Y506C	probably damaging	Het
Hid1	G	A	11: 115,356,750	S274L	possibly damaging	Het
Immp2l	G	T	12: 41,703,765		probably benign	Het
Klhl21	T	C	4: 152,009,624	F228L	possibly damaging	Het
Lars	G	A	18: 42,210,050	R1101C	probably damaging	Het
Magi2	T	C	5: 19,227,332	V15A	probably benign	Het
Map2k7	T	C	8: 4,243,621		probably null	Het
Mga	T	A	2: 119,963,960	H2590Q	possibly damaging	Het
Mlxip	T	C	5: 123,450,223	I238T	possibly damaging	Het
Mylk	T	A	16: 34,875,586	D230E	probably benign	Het
Nacad	T	A	11: 6,601,185	T669S	probably benign	Het
Nin	C	T	12: 70,031,738	M1691I	probably benign	Het
Nlrp4d	C	T	7: 10,382,237	A203T	probably damaging	Het
Olfr1204	T	G	2: 88,852,262	F104C	probably damaging	Het
Olfr1301	A	T	2: 111,754,425	M59L	probably damaging	Het
Olfr1495	A	T	19: 13,768,510	H56L	probably benign	Het
Olfr201	A	G	16: 59,269,031	V212A	probably benign	Het
Olfr433	T	C	1: 174,042,480	F177L	probably benign	Het
Olfr729	C	A	14: 50,148,774	M33I	probably benign	Het
Osbp	C	A	19: 11,977,829	Q282K	probably benign	Het
Osbpl2	A	G	2: 180,148,463	S177G	probably damaging	Het
Pax1	A	G	2: 147,366,255	H261R	possibly damaging	Het
Pcif1	A	T	2: 164,886,727	L274F	probably damaging	Het
Pkhd1	A	G	1: 20,117,825	S3420P	probably benign	Het
Prss3	A	C	6: 41,377,627		probably benign	Het
Ptk2b	T	C	14: 66,163,114	T751A	possibly damaging	Het
Pus10	T	C	11: 23,673,239	V126A	probably damaging	Het
Rai14	A	C	15: 10,587,916	D258E	probably damaging	Het
Rbp3	T	C	14: 33,954,524	V143A	possibly damaging	Het
Sarm1	G	A	11: 78,483,327	Q625*	probably null	Het
Scgb1b21	T	G	7: 33,527,667		noncoding transcript	Het
Scrn1	A	T	6: 54,520,769	V279E	probably damaging	Het
Sipa1l2	T	C	8: 125,421,895	T1670A	probably damaging	Het
Slc9a4	A	T	1: 40,600,962	I305F	probably benign	Het
Smarcc1	A	G	9: 110,213,617	T918A	probably damaging	Het
Tas2r109	A	T	6: 132,980,426	H180Q	probably benign	Het
Tas2r121	G	A	6: 132,700,230	R260*	probably null	Het
Tenm3	T	C	8: 48,279,074	D1249G	probably benign	Het
Tgtp1	C	G	11: 48,987,530	G116A	probably damaging	Het
Tial1	A	G	7: 128,443,910	Y317H	probably damaging	Het
Trim66	A	T	7: 109,455,080	W1308R	probably damaging	Het
Ulk2	T	G	11: 61,783,545	K878N	possibly damaging	Het
Zfp41	T	A	15: 75,618,291	S31T	possibly damaging	Het

Other mutations in Lamc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Lamc1	APN	1	153240495	missense	probably damaging	1.00
IGL01397:Lamc1	APN	1	153251134	missense	probably damaging	1.00
IGL01661:Lamc1	APN	1	153221573	missense	possibly damaging	0.89
IGL01894:Lamc1	APN	1	153247082	missense	possibly damaging	0.51
IGL02000:Lamc1	APN	1	153240433	missense	probably damaging	1.00
IGL02649:Lamc1	APN	1	153247042	missense	possibly damaging	0.78
IGL02749:Lamc1	APN	1	153249853	missense	possibly damaging	0.51
IGL02819:Lamc1	APN	1	153250661	missense	probably damaging	1.00
IGL02831:Lamc1	APN	1	153247055	missense	probably benign	0.00
IGL03069:Lamc1	APN	1	153239381	missense	probably damaging	1.00
IGL03143:Lamc1	APN	1	153332274	missense	probably benign	0.00
IGL03166:Lamc1	APN	1	153332301	missense	probably benign	0.01
IGL03285:Lamc1	APN	1	153227685	missense	possibly damaging	0.96
IGL03294:Lamc1	APN	1	153262646	missense	probably damaging	1.00
pride	UTSW	1	153247284	missense	probably benign	0.01
Stratum	UTSW	1	153251124	nonsense	probably null
tier	UTSW	1	153250522	missense	probably damaging	1.00
PIT4280001:Lamc1	UTSW	1	153243471	missense	probably damaging	1.00
R0003:Lamc1	UTSW	1	153262439	missense	probably damaging	0.99
R0003:Lamc1	UTSW	1	153262439	missense	probably damaging	0.99
R0027:Lamc1	UTSW	1	153262583	missense	probably damaging	1.00
R0060:Lamc1	UTSW	1	153241868	unclassified	probably benign
R0078:Lamc1	UTSW	1	153229190	missense	probably damaging	0.96
R0157:Lamc1	UTSW	1	153262607	missense	probably benign	0.00
R0282:Lamc1	UTSW	1	153255312	missense	probably benign
R0374:Lamc1	UTSW	1	153251065	splice site	probably benign
R0494:Lamc1	UTSW	1	153246936	critical splice donor site	probably null
R0502:Lamc1	UTSW	1	153246932	splice site	probably benign
R0755:Lamc1	UTSW	1	153247450	missense	possibly damaging	0.94
R0791:Lamc1	UTSW	1	153234580	missense	possibly damaging	0.94
R0791:Lamc1	UTSW	1	153234595	missense	probably damaging	1.00
R0791:Lamc1	UTSW	1	153234612	missense	probably benign	0.01
R0792:Lamc1	UTSW	1	153234580	missense	possibly damaging	0.94
R0792:Lamc1	UTSW	1	153234595	missense	probably damaging	1.00
R0792:Lamc1	UTSW	1	153234612	missense	probably benign	0.01
R0892:Lamc1	UTSW	1	153332254	missense	possibly damaging	0.95
R0941:Lamc1	UTSW	1	153332274	missense	possibly damaging	0.72
R0961:Lamc1	UTSW	1	153221646	frame shift	probably null
R0961:Lamc1	UTSW	1	153221700	missense	probably benign	0.03
R0963:Lamc1	UTSW	1	153243386	missense	probably benign
R1127:Lamc1	UTSW	1	153250459	missense	possibly damaging	0.69
R1173:Lamc1	UTSW	1	153247231	splice site	probably benign
R1175:Lamc1	UTSW	1	153247231	splice site	probably benign
R1449:Lamc1	UTSW	1	153250495	missense	probably benign
R1481:Lamc1	UTSW	1	153221634	missense	probably damaging	1.00
R1565:Lamc1	UTSW	1	153242743	missense	probably benign	0.34
R1643:Lamc1	UTSW	1	153258072	splice site	probably benign
R1652:Lamc1	UTSW	1	153249646	missense	probably damaging	1.00
R1691:Lamc1	UTSW	1	153247249	missense	probably benign	0.04
R1854:Lamc1	UTSW	1	153249872	missense	probably damaging	0.99
R2018:Lamc1	UTSW	1	153242632	missense	probably benign	0.07
R2170:Lamc1	UTSW	1	153249142	missense	probably benign	0.07
R2410:Lamc1	UTSW	1	153247395	missense	possibly damaging	0.61
R3438:Lamc1	UTSW	1	153226415	missense	probably benign	0.04
R3615:Lamc1	UTSW	1	153251150	missense	probably damaging	1.00
R3616:Lamc1	UTSW	1	153251150	missense	probably damaging	1.00
R3699:Lamc1	UTSW	1	153255205	missense	possibly damaging	0.79
R3811:Lamc1	UTSW	1	153262708	splice site	probably null
R4285:Lamc1	UTSW	1	153234552	missense	probably damaging	0.99
R4431:Lamc1	UTSW	1	153221528	missense	probably damaging	1.00
R4579:Lamc1	UTSW	1	153247269	missense	probably damaging	1.00
R4625:Lamc1	UTSW	1	153242696	missense	probably benign	0.04
R4649:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4650:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4651:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4652:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4653:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4784:Lamc1	UTSW	1	153231740	missense	probably damaging	1.00
R4785:Lamc1	UTSW	1	153231740	missense	probably damaging	1.00
R4853:Lamc1	UTSW	1	153229100	missense	possibly damaging	0.89
R5216:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5217:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5218:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5219:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5468:Lamc1	UTSW	1	153233564	missense	probably damaging	0.99
R5597:Lamc1	UTSW	1	153251970	missense	probably damaging	1.00
R5754:Lamc1	UTSW	1	153247284	missense	probably benign	0.01
R6233:Lamc1	UTSW	1	153223666	missense	probably benign
R6431:Lamc1	UTSW	1	153221671	missense	probably benign	0.21
R6636:Lamc1	UTSW	1	153241975	missense	possibly damaging	0.93
R6888:Lamc1	UTSW	1	153262492	missense	probably damaging	1.00
R7161:Lamc1	UTSW	1	153226454	missense	probably damaging	1.00
R7240:Lamc1	UTSW	1	153234650	missense	possibly damaging	0.82
R7388:Lamc1	UTSW	1	153249076	missense	probably damaging	1.00
R7474:Lamc1	UTSW	1	153332265	missense	possibly damaging	0.81
R7570:Lamc1	UTSW	1	153243275	missense	possibly damaging	0.64
R7583:Lamc1	UTSW	1	153243232	missense	possibly damaging	0.71
R7597:Lamc1	UTSW	1	153240454	missense	possibly damaging	0.94
R7635:Lamc1	UTSW	1	153249060	missense	probably damaging	1.00
R7976:Lamc1	UTSW	1	153247268	missense	probably damaging	1.00
R8012:Lamc1	UTSW	1	153221612	missense	probably benign	0.04
R8207:Lamc1	UTSW	1	153250522	missense	probably damaging	1.00
R8219:Lamc1	UTSW	1	153247327	missense	probably damaging	1.00
R8227:Lamc1	UTSW	1	153223754	missense	probably benign	0.04
R8315:Lamc1	UTSW	1	153243421	missense	probably benign	0.00
R8417:Lamc1	UTSW	1	153230769	missense	probably damaging	1.00
R8685:Lamc1	UTSW	1	153233542	missense	probably benign	0.31
R8827:Lamc1	UTSW	1	153221678	missense	probably damaging	1.00
R8995:Lamc1	UTSW	1	153332247	missense	probably benign	0.00
R9061:Lamc1	UTSW	1	153251124	nonsense	probably null
R9141:Lamc1	UTSW	1	153247450	missense	probably benign	0.01
R9187:Lamc1	UTSW	1	153221688	nonsense	probably null
R9206:Lamc1	UTSW	1	153250451	missense	probably damaging	1.00
R9222:Lamc1	UTSW	1	153243341	missense	probably damaging	0.96
R9297:Lamc1	UTSW	1	153252000	missense	probably damaging	1.00
R9318:Lamc1	UTSW	1	153252000	missense	probably damaging	1.00
R9377:Lamc1	UTSW	1	153239263	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTATAGATGCACTTCAGGCACTCGC -3'
(R):5'- AGGAAGTATGTCAAGGCCACTCCAC -3'

Sequencing Primer
(F):5'- TGTTGTCGTTACACTGGCAC -3'
(R):5'- TGGATCTCCTGCTcacacc -3'

Posted On

2014-04-24