Incidental Mutation 'R1583:Tial1'
ID 177254
Institutional Source Beutler Lab
Gene Symbol Tial1
Ensembl Gene ENSMUSG00000030846
Gene Name Tia1 cytotoxic granule-associated RNA binding protein-like 1
Synonyms TIAR, mTIAR, 5330433G13Rik
MMRRC Submission 039620-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.814) question?
Stock # R1583 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 128041501-128063441 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 128045634 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 317 (Y317H)
Ref Sequence ENSEMBL: ENSMUSP00000101833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033135] [ENSMUST00000106226] [ENSMUST00000106228] [ENSMUST00000123666] [ENSMUST00000133444] [ENSMUST00000141126] [ENSMUST00000165023] [ENSMUST00000205835] [ENSMUST00000205278]
AlphaFold P70318
Predicted Effect probably damaging
Transcript: ENSMUST00000033135
AA Change: Y300H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033135
Gene: ENSMUSG00000030846
AA Change: Y300H

DomainStartEndE-ValueType
RRM 10 81 3.2e-22 SMART
RRM 98 171 2.76e-26 SMART
RRM 206 273 1.19e-16 SMART
low complexity region 343 366 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106226
AA Change: Y317H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101833
Gene: ENSMUSG00000030846
AA Change: Y317H

DomainStartEndE-ValueType
RRM 10 98 7.41e-18 SMART
RRM 115 188 2.76e-26 SMART
RRM 223 290 1.19e-16 SMART
low complexity region 360 383 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000106228
AA Change: Y261H
SMART Domains Protein: ENSMUSP00000101835
Gene: ENSMUSG00000030846
AA Change: Y261H

DomainStartEndE-ValueType
Pfam:RRM_1 11 50 1.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123666
SMART Domains Protein: ENSMUSP00000116921
Gene: ENSMUSG00000030846

DomainStartEndE-ValueType
RRM 10 81 3.2e-22 SMART
Pfam:RRM_1 99 132 1.3e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133089
Predicted Effect probably benign
Transcript: ENSMUST00000133444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141079
Predicted Effect probably damaging
Transcript: ENSMUST00000141126
AA Change: Y169H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000165023
AA Change: Y300H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126458
Gene: ENSMUSG00000030846
AA Change: Y300H

DomainStartEndE-ValueType
RRM 10 81 3.2e-22 SMART
RRM 98 171 2.76e-26 SMART
RRM 206 273 1.19e-16 SMART
low complexity region 343 366 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205774
Predicted Effect probably benign
Transcript: ENSMUST00000205835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152328
Predicted Effect probably benign
Transcript: ENSMUST00000205278
Meta Mutation Damage Score 0.3177 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of RNA-binding proteins, has three RNA recognition motifs (RRMs), and binds adenine and uridine-rich elements in mRNA and pre-mRNAs of a wide range of genes. It regulates various activities including translational control, splicing and apoptosis. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. The different isoforms have been show to function differently with respect to post-transcriptional silencing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit partial embryonic lethality and reduced postnatal survival, reduced embryonic and postnatal body weight, and male and female sterility. Infertility is owed to a substantial decrease in the survival of primordial germ cells atthe genital ridge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 77,030,528 (GRCm39) S691P probably benign Het
Adgrb3 T C 1: 25,265,912 (GRCm39) probably null Het
Ankar A G 1: 72,718,714 (GRCm39) probably benign Het
Aplf A T 6: 87,623,015 (GRCm39) Y355N probably damaging Het
Bms1 A G 6: 118,366,350 (GRCm39) probably benign Het
Catsperb T C 12: 101,429,373 (GRCm39) I182T probably damaging Het
Cd300ld2 T C 11: 114,904,603 (GRCm39) D88G probably benign Het
Cebpz T C 17: 79,242,181 (GRCm39) N491S probably damaging Het
Crybg2 T C 4: 133,808,770 (GRCm39) S1415P probably damaging Het
Ddc A G 11: 11,779,131 (GRCm39) V331A probably benign Het
Decr2 T C 17: 26,301,998 (GRCm39) E244G probably damaging Het
Dhrs11 A G 11: 84,713,943 (GRCm39) M136T probably damaging Het
Eapp G A 12: 54,732,733 (GRCm39) Q126* probably null Het
Fam111a T A 19: 12,565,142 (GRCm39) V297D probably damaging Het
Fbxo10 A C 4: 45,062,118 (GRCm39) L136R probably damaging Het
Fbxo30 T A 10: 11,167,118 (GRCm39) H613Q possibly damaging Het
Frk A T 10: 34,467,806 (GRCm39) probably null Het
Gm10392 T A 11: 77,408,307 (GRCm39) D104V probably benign Het
Gpn1 A G 5: 31,654,682 (GRCm39) E78G possibly damaging Het
Hhip T C 8: 80,716,905 (GRCm39) Y506C probably damaging Het
Hid1 G A 11: 115,247,576 (GRCm39) S274L possibly damaging Het
Immp2l G T 12: 41,750,548 (GRCm39) probably benign Het
Klhl21 T C 4: 152,094,081 (GRCm39) F228L possibly damaging Het
Lamc1 T A 1: 153,119,224 (GRCm39) probably null Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lratd1 G A 12: 14,200,409 (GRCm39) A106V probably benign Het
Magi2 T C 5: 19,432,330 (GRCm39) V15A probably benign Het
Map2k7 T C 8: 4,293,621 (GRCm39) probably null Het
Mga T A 2: 119,794,441 (GRCm39) H2590Q possibly damaging Het
Mlxip T C 5: 123,588,286 (GRCm39) I238T possibly damaging Het
Mylk T A 16: 34,695,956 (GRCm39) D230E probably benign Het
Nacad T A 11: 6,551,185 (GRCm39) T669S probably benign Het
Nin C T 12: 70,078,512 (GRCm39) M1691I probably benign Het
Nlrp4d C T 7: 10,116,164 (GRCm39) A203T probably damaging Het
Or10aa1 T C 1: 173,870,046 (GRCm39) F177L probably benign Het
Or10q12 A T 19: 13,745,874 (GRCm39) H56L probably benign Het
Or4c106 T G 2: 88,682,606 (GRCm39) F104C probably damaging Het
Or4k5 C A 14: 50,386,231 (GRCm39) M33I probably benign Het
Or4k51 A T 2: 111,584,770 (GRCm39) M59L probably damaging Het
Or5ac19 A G 16: 59,089,394 (GRCm39) V212A probably benign Het
Osbp C A 19: 11,955,193 (GRCm39) Q282K probably benign Het
Osbpl2 A G 2: 179,790,256 (GRCm39) S177G probably damaging Het
Pax1 A G 2: 147,208,175 (GRCm39) H261R possibly damaging Het
Pcif1 A T 2: 164,728,647 (GRCm39) L274F probably damaging Het
Pkhd1 A G 1: 20,188,049 (GRCm39) S3420P probably benign Het
Prss3 A C 6: 41,354,561 (GRCm39) probably benign Het
Ptk2b T C 14: 66,400,563 (GRCm39) T751A possibly damaging Het
Pus10 T C 11: 23,623,239 (GRCm39) V126A probably damaging Het
Rai14 A C 15: 10,588,002 (GRCm39) D258E probably damaging Het
Rbp3 T C 14: 33,676,481 (GRCm39) V143A possibly damaging Het
Sarm1 G A 11: 78,374,153 (GRCm39) Q625* probably null Het
Scgb1b21 T G 7: 33,227,092 (GRCm39) noncoding transcript Het
Scrn1 A T 6: 54,497,754 (GRCm39) V279E probably damaging Het
Sipa1l2 T C 8: 126,148,634 (GRCm39) T1670A probably damaging Het
Slc9a4 A T 1: 40,640,122 (GRCm39) I305F probably benign Het
Smarcc1 A G 9: 110,042,685 (GRCm39) T918A probably damaging Het
Tas2r109 A T 6: 132,957,389 (GRCm39) H180Q probably benign Het
Tas2r121 G A 6: 132,677,193 (GRCm39) R260* probably null Het
Tenm3 T C 8: 48,732,109 (GRCm39) D1249G probably benign Het
Tgtp1 C G 11: 48,878,357 (GRCm39) G116A probably damaging Het
Top6bl T A 19: 4,702,199 (GRCm39) K282N probably damaging Het
Trim66 A T 7: 109,054,287 (GRCm39) W1308R probably damaging Het
Ulk2 T G 11: 61,674,371 (GRCm39) K878N possibly damaging Het
Zfp41 T A 15: 75,490,140 (GRCm39) S31T possibly damaging Het
Other mutations in Tial1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02386:Tial1 APN 7 128,050,069 (GRCm39) missense probably damaging 1.00
IGL02623:Tial1 APN 7 128,045,607 (GRCm39) missense probably benign 0.12
IGL02936:Tial1 APN 7 128,044,387 (GRCm39) splice site probably benign
Neoblimp UTSW 7 128,050,415 (GRCm39) missense possibly damaging 0.94
R0798:Tial1 UTSW 7 128,045,602 (GRCm39) missense probably benign 0.04
R1913:Tial1 UTSW 7 128,046,383 (GRCm39) missense probably damaging 1.00
R4863:Tial1 UTSW 7 128,056,752 (GRCm39) missense probably damaging 1.00
R5026:Tial1 UTSW 7 128,050,120 (GRCm39) missense probably damaging 0.97
R5039:Tial1 UTSW 7 128,045,692 (GRCm39) intron probably benign
R5629:Tial1 UTSW 7 128,046,421 (GRCm39) missense probably damaging 0.97
R6697:Tial1 UTSW 7 128,046,593 (GRCm39) missense possibly damaging 0.94
R8072:Tial1 UTSW 7 128,044,194 (GRCm39) missense unknown
R8178:Tial1 UTSW 7 128,046,614 (GRCm39) missense probably benign 0.01
R8937:Tial1 UTSW 7 128,056,715 (GRCm39) missense probably damaging 1.00
R9162:Tial1 UTSW 7 128,050,415 (GRCm39) missense possibly damaging 0.94
R9385:Tial1 UTSW 7 128,044,209 (GRCm39) missense unknown
Z1177:Tial1 UTSW 7 128,044,363 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCATCTTTTGCCAGAAGCGCATC -3'
(R):5'- TGAACGGCACTACAATCGAAGGAC -3'

Sequencing Primer
(F):5'- GAAGCGCATCTGTTTCTACAATG -3'
(R):5'- ACATACCTACATAGGAGCTTTGG -3'
Posted On 2014-04-24