Incidental Mutation 'R1583:Hhip'
ID177257
Institutional Source Beutler Lab
Gene Symbol Hhip
Ensembl Gene ENSMUSG00000064325
Gene NameHedgehog-interacting protein
SynonymsHip, Hhip1, Hip1
MMRRC Submission 039620-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1583 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location79965851-80058006 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79990276 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 506 (Y506C)
Ref Sequence ENSEMBL: ENSMUSP00000078047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079038]
Predicted Effect probably damaging
Transcript: ENSMUST00000079038
AA Change: Y506C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078047
Gene: ENSMUSG00000064325
AA Change: Y506C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Folate_rec 38 220 4.9e-26 PFAM
Pfam:GSDH 226 444 3e-22 PFAM
EGF 593 635 9.63e0 SMART
EGF 638 667 2.35e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155850
Meta Mutation Damage Score 0.6194 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hedgehog-interacting protein (HHIP) family. The hedgehog (HH) proteins are evolutionarily conserved protein, which are important morphogens for a wide range of developmental processes, including anteroposterior patterns of limbs and regulation of left-right asymmetry in embryonic development. Multiple cell-surface receptors are responsible for transducing and/or regulating HH signals. The HHIP encoded by this gene is a highly conserved, vertebrate-specific inhibitor of HH signaling. It interacts with all three HH family members, SHH, IHH and DHH. Two single nucleotide polymorphisms (SNPs) near this gene are significantly associated with risk of chronic obstructive pulmonary disease (COPD). A single nucleotide polymorphism in this gene is also strongly associated with human height.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a reporter allele die shortly after birth due to respiratory failure, show defects in lung, spleen and pancreas morphogenesis, and exhibit small and disorganized pancreatic islets and reduced beta-cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,882,681 S691P probably benign Het
Adgrb3 T C 1: 25,226,831 probably null Het
Ankar A G 1: 72,679,555 probably benign Het
Aplf A T 6: 87,646,033 Y355N probably damaging Het
Bms1 A G 6: 118,389,389 probably benign Het
Catsperb T C 12: 101,463,114 I182T probably damaging Het
Cd300ld2 T C 11: 115,013,777 D88G probably benign Het
Cebpz T C 17: 78,934,752 N491S probably damaging Het
Crybg2 T C 4: 134,081,459 S1415P probably damaging Het
Ddc A G 11: 11,829,131 V331A probably benign Het
Decr2 T C 17: 26,083,024 E244G probably damaging Het
Dhrs11 A G 11: 84,823,117 M136T probably damaging Het
Eapp G A 12: 54,685,948 Q126* probably null Het
Fam111a T A 19: 12,587,778 V297D probably damaging Het
Fam84a G A 12: 14,150,408 A106V probably benign Het
Fbxo10 A C 4: 45,062,118 L136R probably damaging Het
Fbxo30 T A 10: 11,291,374 H613Q possibly damaging Het
Frk A T 10: 34,591,810 probably null Het
Gm10392 T A 11: 77,517,481 D104V probably benign Het
Gm960 T A 19: 4,652,171 K282N probably damaging Het
Gpn1 A G 5: 31,497,338 E78G possibly damaging Het
Hid1 G A 11: 115,356,750 S274L possibly damaging Het
Immp2l G T 12: 41,703,765 probably benign Het
Klhl21 T C 4: 152,009,624 F228L possibly damaging Het
Lamc1 T A 1: 153,243,478 probably null Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Magi2 T C 5: 19,227,332 V15A probably benign Het
Map2k7 T C 8: 4,243,621 probably null Het
Mga T A 2: 119,963,960 H2590Q possibly damaging Het
Mlxip T C 5: 123,450,223 I238T possibly damaging Het
Mylk T A 16: 34,875,586 D230E probably benign Het
Nacad T A 11: 6,601,185 T669S probably benign Het
Nin C T 12: 70,031,738 M1691I probably benign Het
Nlrp4d C T 7: 10,382,237 A203T probably damaging Het
Olfr1204 T G 2: 88,852,262 F104C probably damaging Het
Olfr1301 A T 2: 111,754,425 M59L probably damaging Het
Olfr1495 A T 19: 13,768,510 H56L probably benign Het
Olfr201 A G 16: 59,269,031 V212A probably benign Het
Olfr433 T C 1: 174,042,480 F177L probably benign Het
Olfr729 C A 14: 50,148,774 M33I probably benign Het
Osbp C A 19: 11,977,829 Q282K probably benign Het
Osbpl2 A G 2: 180,148,463 S177G probably damaging Het
Pax1 A G 2: 147,366,255 H261R possibly damaging Het
Pcif1 A T 2: 164,886,727 L274F probably damaging Het
Pkhd1 A G 1: 20,117,825 S3420P probably benign Het
Prss3 A C 6: 41,377,627 probably benign Het
Ptk2b T C 14: 66,163,114 T751A possibly damaging Het
Pus10 T C 11: 23,673,239 V126A probably damaging Het
Rai14 A C 15: 10,587,916 D258E probably damaging Het
Rbp3 T C 14: 33,954,524 V143A possibly damaging Het
Sarm1 G A 11: 78,483,327 Q625* probably null Het
Scgb1b21 T G 7: 33,527,667 noncoding transcript Het
Scrn1 A T 6: 54,520,769 V279E probably damaging Het
Sipa1l2 T C 8: 125,421,895 T1670A probably damaging Het
Slc9a4 A T 1: 40,600,962 I305F probably benign Het
Smarcc1 A G 9: 110,213,617 T918A probably damaging Het
Tas2r109 A T 6: 132,980,426 H180Q probably benign Het
Tas2r121 G A 6: 132,700,230 R260* probably null Het
Tenm3 T C 8: 48,279,074 D1249G probably benign Het
Tgtp1 C G 11: 48,987,530 G116A probably damaging Het
Tial1 A G 7: 128,443,910 Y317H probably damaging Het
Trim66 A T 7: 109,455,080 W1308R probably damaging Het
Ulk2 T G 11: 61,783,545 K878N possibly damaging Het
Zfp41 T A 15: 75,618,291 S31T possibly damaging Het
Other mutations in Hhip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Hhip APN 8 79996783 missense probably damaging 0.96
IGL02560:Hhip APN 8 79987009 missense probably damaging 0.98
IGL03046:Hhip UTSW 8 79972338 missense probably damaging 0.99
R0068:Hhip UTSW 8 79989256 missense probably damaging 1.00
R0356:Hhip UTSW 8 79997492 missense probably benign 0.20
R0707:Hhip UTSW 8 79998255 missense probably damaging 1.00
R1163:Hhip UTSW 8 79992476 missense probably damaging 1.00
R1900:Hhip UTSW 8 79975046 missense probably benign 0.15
R2071:Hhip UTSW 8 80057302 missense probably benign 0.00
R2255:Hhip UTSW 8 80045181 missense probably damaging 0.98
R3847:Hhip UTSW 8 79997495 missense probably benign 0.00
R4012:Hhip UTSW 8 79992594 missense probably damaging 1.00
R4448:Hhip UTSW 8 80043945 critical splice donor site probably null
R4607:Hhip UTSW 8 79997563 missense probably damaging 0.99
R4608:Hhip UTSW 8 79997563 missense probably damaging 0.99
R4677:Hhip UTSW 8 80045097 missense probably damaging 0.96
R4738:Hhip UTSW 8 79992570 missense probably damaging 0.98
R5040:Hhip UTSW 8 79997606 missense probably benign 0.00
R5371:Hhip UTSW 8 79997591 missense probably damaging 0.98
R5594:Hhip UTSW 8 79996863 missense probably damaging 1.00
R5785:Hhip UTSW 8 79998192 missense possibly damaging 0.84
R6026:Hhip UTSW 8 79972440 missense probably damaging 1.00
R6259:Hhip UTSW 8 79972404 missense probably damaging 1.00
R6782:Hhip UTSW 8 80051604 missense probably damaging 1.00
R7105:Hhip UTSW 8 79975009 missense probably benign 0.04
R7134:Hhip UTSW 8 79992513 missense probably benign
R7238:Hhip UTSW 8 79987012 missense probably benign
R7828:Hhip UTSW 8 79998208 missense probably benign 0.00
R8418:Hhip UTSW 8 80045085 missense probably damaging 0.99
R8814:Hhip UTSW 8 80051472 missense probably damaging 1.00
X0026:Hhip UTSW 8 79992560 missense possibly damaging 0.93
Z1177:Hhip UTSW 8 80057251 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTTATCATCACCCACCATGAGACCTTG -3'
(R):5'- CTGGTGCTTCGATGCCATTTGAAC -3'

Sequencing Primer
(F):5'- accaaccaaccaaccaacc -3'
(R):5'- TTCAGTAACGGCCCTTTGGT -3'
Posted On2014-04-24