Incidental Mutation 'R1583:Smarcc1'
ID 177260
Institutional Source Beutler Lab
Gene Symbol Smarcc1
Ensembl Gene ENSMUSG00000032481
Gene Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
Synonyms BAF155, SRG3, msp3
MMRRC Submission 039620-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1583 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 109961129-110069773 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 110042685 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 918 (T918A)
Ref Sequence ENSEMBL: ENSMUSP00000142611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088716] [ENSMUST00000197984] [ENSMUST00000199896]
AlphaFold P97496
Predicted Effect probably damaging
Transcript: ENSMUST00000088716
AA Change: T918A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086094
Gene: ENSMUSG00000032481
AA Change: T918A

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
CHROMO 214 260 3.06e-3 SMART
low complexity region 321 333 N/A INTRINSIC
Pfam:SWIRM 450 536 1.7e-33 PFAM
SANT 618 666 4.52e-12 SMART
Pfam:SWIRM-assoc_3 705 771 9.6e-35 PFAM
low complexity region 830 839 N/A INTRINSIC
Pfam:SWIRM-assoc_1 870 953 2.5e-34 PFAM
low complexity region 955 973 N/A INTRINSIC
low complexity region 986 1031 N/A INTRINSIC
low complexity region 1043 1058 N/A INTRINSIC
low complexity region 1075 1104 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197984
AA Change: T918A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142611
Gene: ENSMUSG00000032481
AA Change: T918A

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
CHROMO 214 260 3.06e-3 SMART
low complexity region 321 333 N/A INTRINSIC
Pfam:SWIRM 448 536 1.4e-35 PFAM
SANT 618 666 4.52e-12 SMART
low complexity region 710 717 N/A INTRINSIC
low complexity region 723 734 N/A INTRINSIC
low complexity region 768 781 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 866 885 N/A INTRINSIC
coiled coil region 909 945 N/A INTRINSIC
low complexity region 955 973 N/A INTRINSIC
low complexity region 986 1031 N/A INTRINSIC
low complexity region 1043 1058 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199896
AA Change: T918A

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143550
Gene: ENSMUSG00000032481
AA Change: T918A

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
CHROMO 214 260 3.06e-3 SMART
low complexity region 321 333 N/A INTRINSIC
Pfam:SWIRM 450 536 1.5e-33 PFAM
SANT 618 666 4.52e-12 SMART
Pfam:SWIRM-assoc_3 705 771 1.4e-34 PFAM
low complexity region 830 839 N/A INTRINSIC
Pfam:SWIRM-assoc_1 870 953 1.4e-34 PFAM
low complexity region 955 973 N/A INTRINSIC
low complexity region 986 1031 N/A INTRINSIC
low complexity region 1043 1058 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200237
Meta Mutation Damage Score 0.0999 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and contains a predicted leucine zipper motif typical of many transcription factors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out mutation display early embryonic lethality soon after decidualization due to failed egg cylinder formation and defects in the inner cell mass and primitive endoderm. About 20% of heterozygous mutant embryos show exencephaly caused by failure in neural fold elevation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 77,030,528 (GRCm39) S691P probably benign Het
Adgrb3 T C 1: 25,265,912 (GRCm39) probably null Het
Ankar A G 1: 72,718,714 (GRCm39) probably benign Het
Aplf A T 6: 87,623,015 (GRCm39) Y355N probably damaging Het
Bms1 A G 6: 118,366,350 (GRCm39) probably benign Het
Catsperb T C 12: 101,429,373 (GRCm39) I182T probably damaging Het
Cd300ld2 T C 11: 114,904,603 (GRCm39) D88G probably benign Het
Cebpz T C 17: 79,242,181 (GRCm39) N491S probably damaging Het
Crybg2 T C 4: 133,808,770 (GRCm39) S1415P probably damaging Het
Ddc A G 11: 11,779,131 (GRCm39) V331A probably benign Het
Decr2 T C 17: 26,301,998 (GRCm39) E244G probably damaging Het
Dhrs11 A G 11: 84,713,943 (GRCm39) M136T probably damaging Het
Eapp G A 12: 54,732,733 (GRCm39) Q126* probably null Het
Fam111a T A 19: 12,565,142 (GRCm39) V297D probably damaging Het
Fbxo10 A C 4: 45,062,118 (GRCm39) L136R probably damaging Het
Fbxo30 T A 10: 11,167,118 (GRCm39) H613Q possibly damaging Het
Frk A T 10: 34,467,806 (GRCm39) probably null Het
Gm10392 T A 11: 77,408,307 (GRCm39) D104V probably benign Het
Gpn1 A G 5: 31,654,682 (GRCm39) E78G possibly damaging Het
Hhip T C 8: 80,716,905 (GRCm39) Y506C probably damaging Het
Hid1 G A 11: 115,247,576 (GRCm39) S274L possibly damaging Het
Immp2l G T 12: 41,750,548 (GRCm39) probably benign Het
Klhl21 T C 4: 152,094,081 (GRCm39) F228L possibly damaging Het
Lamc1 T A 1: 153,119,224 (GRCm39) probably null Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lratd1 G A 12: 14,200,409 (GRCm39) A106V probably benign Het
Magi2 T C 5: 19,432,330 (GRCm39) V15A probably benign Het
Map2k7 T C 8: 4,293,621 (GRCm39) probably null Het
Mga T A 2: 119,794,441 (GRCm39) H2590Q possibly damaging Het
Mlxip T C 5: 123,588,286 (GRCm39) I238T possibly damaging Het
Mylk T A 16: 34,695,956 (GRCm39) D230E probably benign Het
Nacad T A 11: 6,551,185 (GRCm39) T669S probably benign Het
Nin C T 12: 70,078,512 (GRCm39) M1691I probably benign Het
Nlrp4d C T 7: 10,116,164 (GRCm39) A203T probably damaging Het
Or10aa1 T C 1: 173,870,046 (GRCm39) F177L probably benign Het
Or10q12 A T 19: 13,745,874 (GRCm39) H56L probably benign Het
Or4c106 T G 2: 88,682,606 (GRCm39) F104C probably damaging Het
Or4k5 C A 14: 50,386,231 (GRCm39) M33I probably benign Het
Or4k51 A T 2: 111,584,770 (GRCm39) M59L probably damaging Het
Or5ac19 A G 16: 59,089,394 (GRCm39) V212A probably benign Het
Osbp C A 19: 11,955,193 (GRCm39) Q282K probably benign Het
Osbpl2 A G 2: 179,790,256 (GRCm39) S177G probably damaging Het
Pax1 A G 2: 147,208,175 (GRCm39) H261R possibly damaging Het
Pcif1 A T 2: 164,728,647 (GRCm39) L274F probably damaging Het
Pkhd1 A G 1: 20,188,049 (GRCm39) S3420P probably benign Het
Prss3 A C 6: 41,354,561 (GRCm39) probably benign Het
Ptk2b T C 14: 66,400,563 (GRCm39) T751A possibly damaging Het
Pus10 T C 11: 23,623,239 (GRCm39) V126A probably damaging Het
Rai14 A C 15: 10,588,002 (GRCm39) D258E probably damaging Het
Rbp3 T C 14: 33,676,481 (GRCm39) V143A possibly damaging Het
Sarm1 G A 11: 78,374,153 (GRCm39) Q625* probably null Het
Scgb1b21 T G 7: 33,227,092 (GRCm39) noncoding transcript Het
Scrn1 A T 6: 54,497,754 (GRCm39) V279E probably damaging Het
Sipa1l2 T C 8: 126,148,634 (GRCm39) T1670A probably damaging Het
Slc9a4 A T 1: 40,640,122 (GRCm39) I305F probably benign Het
Tas2r109 A T 6: 132,957,389 (GRCm39) H180Q probably benign Het
Tas2r121 G A 6: 132,677,193 (GRCm39) R260* probably null Het
Tenm3 T C 8: 48,732,109 (GRCm39) D1249G probably benign Het
Tgtp1 C G 11: 48,878,357 (GRCm39) G116A probably damaging Het
Tial1 A G 7: 128,045,634 (GRCm39) Y317H probably damaging Het
Top6bl T A 19: 4,702,199 (GRCm39) K282N probably damaging Het
Trim66 A T 7: 109,054,287 (GRCm39) W1308R probably damaging Het
Ulk2 T G 11: 61,674,371 (GRCm39) K878N possibly damaging Het
Zfp41 T A 15: 75,490,140 (GRCm39) S31T possibly damaging Het
Other mutations in Smarcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Smarcc1 APN 9 110,051,005 (GRCm39) missense probably damaging 1.00
IGL01152:Smarcc1 APN 9 109,968,693 (GRCm39) missense possibly damaging 0.89
IGL01353:Smarcc1 APN 9 109,964,734 (GRCm39) missense probably benign 0.07
IGL01401:Smarcc1 APN 9 109,979,033 (GRCm39) missense possibly damaging 0.52
IGL01483:Smarcc1 APN 9 110,051,128 (GRCm39) nonsense probably null
IGL01679:Smarcc1 APN 9 110,042,598 (GRCm39) missense probably damaging 1.00
IGL02458:Smarcc1 APN 9 109,961,194 (GRCm39) intron probably benign
IGL02498:Smarcc1 APN 9 110,020,002 (GRCm39) missense probably damaging 1.00
IGL02605:Smarcc1 APN 9 110,051,068 (GRCm39) missense possibly damaging 0.86
IGL03003:Smarcc1 APN 9 110,035,168 (GRCm39) missense probably damaging 0.97
IGL03284:Smarcc1 APN 9 110,004,142 (GRCm39) missense probably benign 0.30
R0116:Smarcc1 UTSW 9 109,976,172 (GRCm39) missense possibly damaging 0.71
R0403:Smarcc1 UTSW 9 110,066,876 (GRCm39) splice site probably null
R1436:Smarcc1 UTSW 9 109,947,708 (GRCm39) unclassified probably benign
R1692:Smarcc1 UTSW 9 110,003,072 (GRCm39) missense possibly damaging 0.85
R1732:Smarcc1 UTSW 9 110,014,888 (GRCm39) splice site probably benign
R1833:Smarcc1 UTSW 9 109,982,879 (GRCm39) missense possibly damaging 0.71
R1881:Smarcc1 UTSW 9 110,004,167 (GRCm39) missense probably damaging 1.00
R2058:Smarcc1 UTSW 9 109,947,411 (GRCm39) unclassified probably benign
R2175:Smarcc1 UTSW 9 109,993,877 (GRCm39) missense possibly damaging 0.71
R2215:Smarcc1 UTSW 9 110,066,907 (GRCm39) utr 3 prime probably benign
R2904:Smarcc1 UTSW 9 110,003,043 (GRCm39) missense possibly damaging 0.80
R3899:Smarcc1 UTSW 9 109,947,586 (GRCm39) unclassified probably benign
R3900:Smarcc1 UTSW 9 109,947,586 (GRCm39) unclassified probably benign
R4012:Smarcc1 UTSW 9 109,961,273 (GRCm39) missense possibly damaging 0.96
R4091:Smarcc1 UTSW 9 109,993,897 (GRCm39) missense possibly damaging 0.84
R4356:Smarcc1 UTSW 9 110,025,324 (GRCm39) missense probably damaging 0.99
R4881:Smarcc1 UTSW 9 109,964,696 (GRCm39) start gained probably benign
R4993:Smarcc1 UTSW 9 110,004,129 (GRCm39) missense probably damaging 1.00
R5110:Smarcc1 UTSW 9 110,026,852 (GRCm39) missense possibly damaging 0.89
R5375:Smarcc1 UTSW 9 110,020,017 (GRCm39) missense probably damaging 0.99
R5655:Smarcc1 UTSW 9 109,986,412 (GRCm39) missense probably null 1.00
R5715:Smarcc1 UTSW 9 110,025,435 (GRCm39) missense possibly damaging 0.95
R5767:Smarcc1 UTSW 9 109,961,251 (GRCm39) intron probably benign
R5816:Smarcc1 UTSW 9 110,026,712 (GRCm39) missense possibly damaging 0.51
R6969:Smarcc1 UTSW 9 110,025,388 (GRCm39) missense probably damaging 1.00
R7068:Smarcc1 UTSW 9 110,014,952 (GRCm39) missense probably damaging 1.00
R7211:Smarcc1 UTSW 9 109,979,082 (GRCm39) missense probably damaging 0.97
R7558:Smarcc1 UTSW 9 109,976,184 (GRCm39) missense probably damaging 0.96
R7903:Smarcc1 UTSW 9 110,033,334 (GRCm39) missense probably benign 0.01
R8190:Smarcc1 UTSW 9 110,031,602 (GRCm39) missense probably benign
R8695:Smarcc1 UTSW 9 110,002,972 (GRCm39) missense probably damaging 0.98
R8842:Smarcc1 UTSW 9 110,051,199 (GRCm39) missense possibly damaging 0.60
R9024:Smarcc1 UTSW 9 110,015,001 (GRCm39) missense probably damaging 0.99
R9131:Smarcc1 UTSW 9 109,964,710 (GRCm39) missense possibly damaging 0.73
R9180:Smarcc1 UTSW 9 109,964,728 (GRCm39) missense probably damaging 1.00
R9279:Smarcc1 UTSW 9 109,996,792 (GRCm39) missense possibly damaging 0.69
R9352:Smarcc1 UTSW 9 110,035,220 (GRCm39) missense probably null 1.00
R9538:Smarcc1 UTSW 9 109,961,272 (GRCm39) missense probably benign 0.00
R9645:Smarcc1 UTSW 9 109,986,410 (GRCm39) missense probably damaging 1.00
T0722:Smarcc1 UTSW 9 110,035,153 (GRCm39) missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACTATACGTTGGTTCCATAgtgtggaga -3'
(R):5'- GCGACAGAGATACAGTCAAAGGTCAAAT -3'

Sequencing Primer
(F):5'- gtacctttacccactgagcc -3'
(R):5'- aaacaggaaaatcaagaatagaggg -3'
Posted On 2014-04-24