Incidental Mutation 'R1583:Nacad'
ID177263
Institutional Source Beutler Lab
Gene Symbol Nacad
Ensembl Gene ENSMUSG00000041073
Gene NameNAC alpha domain containing
SynonymsmKIAA0363
MMRRC Submission 039620-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1583 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location6597823-6606053 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6601185 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 669 (T669S)
Ref Sequence ENSEMBL: ENSMUSP00000049490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000388] [ENSMUST00000045713] [ENSMUST00000109721] [ENSMUST00000109722]
Predicted Effect probably benign
Transcript: ENSMUST00000000388
SMART Domains Protein: ENSMUSP00000000388
Gene: ENSMUSG00000000378

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Blast:PTB 60 230 2e-35 BLAST
low complexity region 242 252 N/A INTRINSIC
Pfam:CCM2_C 296 396 8.9e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045713
AA Change: T669S

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000049490
Gene: ENSMUSG00000041073
AA Change: T669S

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 70 87 N/A INTRINSIC
low complexity region 228 235 N/A INTRINSIC
low complexity region 266 277 N/A INTRINSIC
low complexity region 294 306 N/A INTRINSIC
low complexity region 328 354 N/A INTRINSIC
low complexity region 391 422 N/A INTRINSIC
low complexity region 454 479 N/A INTRINSIC
internal_repeat_1 537 689 6.19e-8 PROSPERO
low complexity region 692 713 N/A INTRINSIC
internal_repeat_1 732 889 6.19e-8 PROSPERO
low complexity region 924 939 N/A INTRINSIC
low complexity region 1159 1170 N/A INTRINSIC
low complexity region 1308 1325 N/A INTRINSIC
Pfam:NAC 1357 1413 2.9e-24 PFAM
low complexity region 1449 1466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109721
SMART Domains Protein: ENSMUSP00000105343
Gene: ENSMUSG00000000378

DomainStartEndE-ValueType
Blast:PTB 2 166 2e-32 BLAST
low complexity region 178 188 N/A INTRINSIC
low complexity region 230 244 N/A INTRINSIC
PDB:4FQN|D 245 324 5e-52 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000109722
SMART Domains Protein: ENSMUSP00000105344
Gene: ENSMUSG00000000378

DomainStartEndE-ValueType
Blast:PTB 2 166 2e-32 BLAST
low complexity region 178 188 N/A INTRINSIC
low complexity region 230 244 N/A INTRINSIC
PDB:4FQN|D 245 324 5e-52 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000177050
Predicted Effect probably benign
Transcript: ENSMUST00000177391
Meta Mutation Damage Score 0.0597 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 99% (79/80)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,882,681 S691P probably benign Het
Adgrb3 T C 1: 25,226,831 probably null Het
Ankar A G 1: 72,679,555 probably benign Het
Aplf A T 6: 87,646,033 Y355N probably damaging Het
Bms1 A G 6: 118,389,389 probably benign Het
Catsperb T C 12: 101,463,114 I182T probably damaging Het
Cd300ld2 T C 11: 115,013,777 D88G probably benign Het
Cebpz T C 17: 78,934,752 N491S probably damaging Het
Crybg2 T C 4: 134,081,459 S1415P probably damaging Het
Ddc A G 11: 11,829,131 V331A probably benign Het
Decr2 T C 17: 26,083,024 E244G probably damaging Het
Dhrs11 A G 11: 84,823,117 M136T probably damaging Het
Eapp G A 12: 54,685,948 Q126* probably null Het
Fam111a T A 19: 12,587,778 V297D probably damaging Het
Fam84a G A 12: 14,150,408 A106V probably benign Het
Fbxo10 A C 4: 45,062,118 L136R probably damaging Het
Fbxo30 T A 10: 11,291,374 H613Q possibly damaging Het
Frk A T 10: 34,591,810 probably null Het
Gm10392 T A 11: 77,517,481 D104V probably benign Het
Gm960 T A 19: 4,652,171 K282N probably damaging Het
Gpn1 A G 5: 31,497,338 E78G possibly damaging Het
Hhip T C 8: 79,990,276 Y506C probably damaging Het
Hid1 G A 11: 115,356,750 S274L possibly damaging Het
Immp2l G T 12: 41,703,765 probably benign Het
Klhl21 T C 4: 152,009,624 F228L possibly damaging Het
Lamc1 T A 1: 153,243,478 probably null Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Magi2 T C 5: 19,227,332 V15A probably benign Het
Map2k7 T C 8: 4,243,621 probably null Het
Mga T A 2: 119,963,960 H2590Q possibly damaging Het
Mlxip T C 5: 123,450,223 I238T possibly damaging Het
Mylk T A 16: 34,875,586 D230E probably benign Het
Nin C T 12: 70,031,738 M1691I probably benign Het
Nlrp4d C T 7: 10,382,237 A203T probably damaging Het
Olfr1204 T G 2: 88,852,262 F104C probably damaging Het
Olfr1301 A T 2: 111,754,425 M59L probably damaging Het
Olfr1495 A T 19: 13,768,510 H56L probably benign Het
Olfr201 A G 16: 59,269,031 V212A probably benign Het
Olfr433 T C 1: 174,042,480 F177L probably benign Het
Olfr729 C A 14: 50,148,774 M33I probably benign Het
Osbp C A 19: 11,977,829 Q282K probably benign Het
Osbpl2 A G 2: 180,148,463 S177G probably damaging Het
Pax1 A G 2: 147,366,255 H261R possibly damaging Het
Pcif1 A T 2: 164,886,727 L274F probably damaging Het
Pkhd1 A G 1: 20,117,825 S3420P probably benign Het
Prss3 A C 6: 41,377,627 probably benign Het
Ptk2b T C 14: 66,163,114 T751A possibly damaging Het
Pus10 T C 11: 23,673,239 V126A probably damaging Het
Rai14 A C 15: 10,587,916 D258E probably damaging Het
Rbp3 T C 14: 33,954,524 V143A possibly damaging Het
Sarm1 G A 11: 78,483,327 Q625* probably null Het
Scgb1b21 T G 7: 33,527,667 noncoding transcript Het
Scrn1 A T 6: 54,520,769 V279E probably damaging Het
Sipa1l2 T C 8: 125,421,895 T1670A probably damaging Het
Slc9a4 A T 1: 40,600,962 I305F probably benign Het
Smarcc1 A G 9: 110,213,617 T918A probably damaging Het
Tas2r109 A T 6: 132,980,426 H180Q probably benign Het
Tas2r121 G A 6: 132,700,230 R260* probably null Het
Tenm3 T C 8: 48,279,074 D1249G probably benign Het
Tgtp1 C G 11: 48,987,530 G116A probably damaging Het
Tial1 A G 7: 128,443,910 Y317H probably damaging Het
Trim66 A T 7: 109,455,080 W1308R probably damaging Het
Ulk2 T G 11: 61,783,545 K878N possibly damaging Het
Zfp41 T A 15: 75,618,291 S31T possibly damaging Het
Other mutations in Nacad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Nacad APN 11 6600921 missense probably benign 0.24
IGL00903:Nacad APN 11 6600632 missense probably damaging 0.99
IGL01303:Nacad APN 11 6598279 missense possibly damaging 0.81
IGL01353:Nacad APN 11 6600530 missense possibly damaging 0.70
IGL01833:Nacad APN 11 6605700 missense unknown
IGL02267:Nacad APN 11 6602649 missense probably benign 0.14
IGL02531:Nacad APN 11 6598580 missense possibly damaging 0.90
IGL02994:Nacad APN 11 6599528 missense possibly damaging 0.83
IGL03121:Nacad APN 11 6600933 missense probably damaging 0.98
IGL03161:Nacad APN 11 6600378 nonsense probably null
FR4340:Nacad UTSW 11 6599761 small insertion probably benign
FR4342:Nacad UTSW 11 6599762 small insertion probably benign
FR4548:Nacad UTSW 11 6599752 small insertion probably benign
FR4548:Nacad UTSW 11 6599760 small insertion probably benign
FR4589:Nacad UTSW 11 6599753 small insertion probably benign
FR4976:Nacad UTSW 11 6599749 small insertion probably benign
FR4976:Nacad UTSW 11 6599756 small insertion probably benign
FR4976:Nacad UTSW 11 6599763 small insertion probably benign
PIT4402001:Nacad UTSW 11 6598621 missense probably benign 0.19
R0330:Nacad UTSW 11 6600903 missense probably benign
R0331:Nacad UTSW 11 6599441 missense possibly damaging 0.84
R0409:Nacad UTSW 11 6599810 missense probably benign 0.00
R0612:Nacad UTSW 11 6601382 missense possibly damaging 0.90
R0644:Nacad UTSW 11 6599486 missense possibly damaging 0.69
R0829:Nacad UTSW 11 6601158 missense probably benign 0.18
R1483:Nacad UTSW 11 6602217 missense probably damaging 0.99
R1905:Nacad UTSW 11 6602540 missense probably benign 0.15
R1907:Nacad UTSW 11 6602540 missense probably benign 0.15
R2361:Nacad UTSW 11 6600821 missense probably benign
R2979:Nacad UTSW 11 6601424 missense probably benign 0.06
R4192:Nacad UTSW 11 6605534 missense probably benign 0.44
R4381:Nacad UTSW 11 6600204 missense probably benign 0.18
R4539:Nacad UTSW 11 6600677 missense possibly damaging 0.94
R4751:Nacad UTSW 11 6605726 missense unknown
R4944:Nacad UTSW 11 6598507 missense possibly damaging 0.95
R4962:Nacad UTSW 11 6599169 missense probably damaging 1.00
R5102:Nacad UTSW 11 6598528 missense probably damaging 1.00
R5189:Nacad UTSW 11 6601611 missense probably damaging 0.98
R5296:Nacad UTSW 11 6605745 missense unknown
R5566:Nacad UTSW 11 6602136 missense probably damaging 1.00
R5634:Nacad UTSW 11 6602387 missense possibly damaging 0.88
R5725:Nacad UTSW 11 6601643 missense probably benign 0.15
R5748:Nacad UTSW 11 6598370 nonsense probably null
R5864:Nacad UTSW 11 6600581 missense probably benign
R5882:Nacad UTSW 11 6598568 missense possibly damaging 0.95
R6089:Nacad UTSW 11 6601331 missense probably benign 0.03
R6117:Nacad UTSW 11 6599810 missense probably benign 0.00
R6161:Nacad UTSW 11 6600902 missense probably benign
R6351:Nacad UTSW 11 6599235 missense probably damaging 1.00
R6351:Nacad UTSW 11 6600165 nonsense probably null
R6366:Nacad UTSW 11 6601196 missense probably benign 0.30
R6525:Nacad UTSW 11 6602255 missense probably damaging 1.00
R6811:Nacad UTSW 11 6599400 missense possibly damaging 0.66
R6931:Nacad UTSW 11 6601877 missense probably benign 0.14
R6966:Nacad UTSW 11 6602634 missense possibly damaging 0.93
R7228:Nacad UTSW 11 6598412 missense probably benign 0.19
R7248:Nacad UTSW 11 6598589 nonsense probably null
R7556:Nacad UTSW 11 6601272 missense possibly damaging 0.90
R7594:Nacad UTSW 11 6602457 missense probably damaging 0.99
R7813:Nacad UTSW 11 6599071 missense probably benign 0.38
R7841:Nacad UTSW 11 6601031 missense probably benign 0.00
R7924:Nacad UTSW 11 6601031 missense probably benign 0.00
T0975:Nacad UTSW 11 6599750 small insertion probably benign
T0975:Nacad UTSW 11 6601622 missense probably benign 0.03
T0975:Nacad UTSW 11 6601632 missense probably benign 0.17
X0011:Nacad UTSW 11 6601074 missense probably benign 0.00
Z1176:Nacad UTSW 11 6602297 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGGTGATGCTACTGGGGCAAC -3'
(R):5'- AGCTTGTGTCCAGTCCTTCCTGAG -3'

Sequencing Primer
(F):5'- GGTGACCACAACTTCAGGTTC -3'
(R):5'- TTCCTGAGAAGAAGGAAGAAGGC -3'
Posted On2014-04-24