Incidental Mutation 'R1583:Ulk2'
Institutional Source Beutler Lab
Gene Symbol Ulk2
Ensembl Gene ENSMUSG00000004798
Gene Nameunc-51 like kinase 2
SynonymsUnc51.2, A830085I22Rik
MMRRC Submission 039620-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.386) question?
Stock #R1583 (G1)
Quality Score225
Status Validated
Chromosomal Location61775649-61855073 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 61783545 bp
Amino Acid Change Lysine to Asparagine at position 878 (K878N)
Ref Sequence ENSEMBL: ENSMUSP00000004920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004920]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004920
AA Change: K878N

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000004920
Gene: ENSMUSG00000004798
AA Change: K878N

S_TKc 9 271 1.1e-93 SMART
low complexity region 274 309 N/A INTRINSIC
Blast:S_TKc 310 413 9e-28 BLAST
Blast:S_TKc 433 738 1e-29 BLAST
low complexity region 751 766 N/A INTRINSIC
low complexity region 771 791 N/A INTRINSIC
Pfam:DUF3543 821 1032 1.8e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129025
Meta Mutation Damage Score 0.0600 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to a serine/threonine kinase in C. elegans which is involved in axonal elongation. The structure of this protein is similar to the C. elegans protein in that both proteins have an N-terminal kinase domain, a central proline/serine rich (PS) domain, and a C-terminal (C) domain. The gene is located within the Smith-Magenis syndrome region on chromosome 17. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutation of this gene results in an increased anxiety-like response in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,882,681 S691P probably benign Het
Adgrb3 T C 1: 25,226,831 probably null Het
Ankar A G 1: 72,679,555 probably benign Het
Aplf A T 6: 87,646,033 Y355N probably damaging Het
Bms1 A G 6: 118,389,389 probably benign Het
Catsperb T C 12: 101,463,114 I182T probably damaging Het
Cd300ld2 T C 11: 115,013,777 D88G probably benign Het
Cebpz T C 17: 78,934,752 N491S probably damaging Het
Crybg2 T C 4: 134,081,459 S1415P probably damaging Het
Ddc A G 11: 11,829,131 V331A probably benign Het
Decr2 T C 17: 26,083,024 E244G probably damaging Het
Dhrs11 A G 11: 84,823,117 M136T probably damaging Het
Eapp G A 12: 54,685,948 Q126* probably null Het
Fam111a T A 19: 12,587,778 V297D probably damaging Het
Fam84a G A 12: 14,150,408 A106V probably benign Het
Fbxo10 A C 4: 45,062,118 L136R probably damaging Het
Fbxo30 T A 10: 11,291,374 H613Q possibly damaging Het
Frk A T 10: 34,591,810 probably null Het
Gm10392 T A 11: 77,517,481 D104V probably benign Het
Gm960 T A 19: 4,652,171 K282N probably damaging Het
Gpn1 A G 5: 31,497,338 E78G possibly damaging Het
Hhip T C 8: 79,990,276 Y506C probably damaging Het
Hid1 G A 11: 115,356,750 S274L possibly damaging Het
Immp2l G T 12: 41,703,765 probably benign Het
Klhl21 T C 4: 152,009,624 F228L possibly damaging Het
Lamc1 T A 1: 153,243,478 probably null Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Magi2 T C 5: 19,227,332 V15A probably benign Het
Map2k7 T C 8: 4,243,621 probably null Het
Mga T A 2: 119,963,960 H2590Q possibly damaging Het
Mlxip T C 5: 123,450,223 I238T possibly damaging Het
Mylk T A 16: 34,875,586 D230E probably benign Het
Nacad T A 11: 6,601,185 T669S probably benign Het
Nin C T 12: 70,031,738 M1691I probably benign Het
Nlrp4d C T 7: 10,382,237 A203T probably damaging Het
Olfr1204 T G 2: 88,852,262 F104C probably damaging Het
Olfr1301 A T 2: 111,754,425 M59L probably damaging Het
Olfr1495 A T 19: 13,768,510 H56L probably benign Het
Olfr201 A G 16: 59,269,031 V212A probably benign Het
Olfr433 T C 1: 174,042,480 F177L probably benign Het
Olfr729 C A 14: 50,148,774 M33I probably benign Het
Osbp C A 19: 11,977,829 Q282K probably benign Het
Osbpl2 A G 2: 180,148,463 S177G probably damaging Het
Pax1 A G 2: 147,366,255 H261R possibly damaging Het
Pcif1 A T 2: 164,886,727 L274F probably damaging Het
Pkhd1 A G 1: 20,117,825 S3420P probably benign Het
Prss3 A C 6: 41,377,627 probably benign Het
Ptk2b T C 14: 66,163,114 T751A possibly damaging Het
Pus10 T C 11: 23,673,239 V126A probably damaging Het
Rai14 A C 15: 10,587,916 D258E probably damaging Het
Rbp3 T C 14: 33,954,524 V143A possibly damaging Het
Sarm1 G A 11: 78,483,327 Q625* probably null Het
Scgb1b21 T G 7: 33,527,667 noncoding transcript Het
Scrn1 A T 6: 54,520,769 V279E probably damaging Het
Sipa1l2 T C 8: 125,421,895 T1670A probably damaging Het
Slc9a4 A T 1: 40,600,962 I305F probably benign Het
Smarcc1 A G 9: 110,213,617 T918A probably damaging Het
Tas2r109 A T 6: 132,980,426 H180Q probably benign Het
Tas2r121 G A 6: 132,700,230 R260* probably null Het
Tenm3 T C 8: 48,279,074 D1249G probably benign Het
Tgtp1 C G 11: 48,987,530 G116A probably damaging Het
Tial1 A G 7: 128,443,910 Y317H probably damaging Het
Trim66 A T 7: 109,455,080 W1308R probably damaging Het
Zfp41 T A 15: 75,618,291 S31T possibly damaging Het
Other mutations in Ulk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Ulk2 APN 11 61791436 nonsense probably null
IGL02044:Ulk2 APN 11 61781639 missense probably damaging 1.00
IGL02185:Ulk2 APN 11 61782060 missense probably damaging 1.00
IGL03036:Ulk2 APN 11 61834834 missense probably damaging 1.00
BB007:Ulk2 UTSW 11 61791432 critical splice donor site probably null
BB009:Ulk2 UTSW 11 61808090 missense probably benign
BB017:Ulk2 UTSW 11 61791432 critical splice donor site probably null
BB019:Ulk2 UTSW 11 61808090 missense probably benign
R0207:Ulk2 UTSW 11 61777785 missense probably benign 0.42
R0362:Ulk2 UTSW 11 61787586 missense probably benign
R0657:Ulk2 UTSW 11 61808054 splice site probably benign
R1076:Ulk2 UTSW 11 61819309 missense probably damaging 1.00
R1144:Ulk2 UTSW 11 61800060 missense possibly damaging 0.80
R1573:Ulk2 UTSW 11 61779755 missense probably damaging 1.00
R1619:Ulk2 UTSW 11 61781746 missense probably damaging 1.00
R1757:Ulk2 UTSW 11 61841339 splice site probably benign
R1845:Ulk2 UTSW 11 61812738 missense probably benign 0.04
R1883:Ulk2 UTSW 11 61830612 missense probably damaging 1.00
R1966:Ulk2 UTSW 11 61819471 splice site probably null
R2177:Ulk2 UTSW 11 61791509 missense probably benign 0.01
R2416:Ulk2 UTSW 11 61782039 missense probably damaging 1.00
R2509:Ulk2 UTSW 11 61787514 missense probably benign 0.00
R2847:Ulk2 UTSW 11 61824729 critical splice acceptor site probably null
R4736:Ulk2 UTSW 11 61833435 missense probably damaging 1.00
R4997:Ulk2 UTSW 11 61799156 missense probably benign 0.00
R5081:Ulk2 UTSW 11 61803662 missense probably damaging 1.00
R5190:Ulk2 UTSW 11 61781711 missense probably benign
R5346:Ulk2 UTSW 11 61834914 missense probably damaging 1.00
R5348:Ulk2 UTSW 11 61783613 missense probably benign
R5520:Ulk2 UTSW 11 61808144 missense probably damaging 1.00
R5954:Ulk2 UTSW 11 61803796 splice site probably benign
R6153:Ulk2 UTSW 11 61781746 missense probably damaging 1.00
R6223:Ulk2 UTSW 11 61787504 nonsense probably null
R7204:Ulk2 UTSW 11 61783631 missense probably benign 0.11
R7205:Ulk2 UTSW 11 61834831 missense possibly damaging 0.84
R7259:Ulk2 UTSW 11 61782083 missense probably damaging 1.00
R7353:Ulk2 UTSW 11 61819348 missense probably damaging 1.00
R7734:Ulk2 UTSW 11 61853301 nonsense probably null
R7797:Ulk2 UTSW 11 61782102 missense probably benign 0.06
R7808:Ulk2 UTSW 11 61854552 missense probably damaging 1.00
R7930:Ulk2 UTSW 11 61791432 critical splice donor site probably null
R7932:Ulk2 UTSW 11 61808090 missense probably benign
X0028:Ulk2 UTSW 11 61799568 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gagaaaggtatggtggcaaag -3'
Posted On2014-04-24