Incidental Mutation 'R1583:Immp2l'
ID177274
Institutional Source Beutler Lab
Gene Symbol Immp2l
Ensembl Gene ENSMUSG00000056899
Gene NameIMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)
SynonymsIMP2
MMRRC Submission 039620-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1583 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location41024090-41955588 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 41703765 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000132121] [ENSMUST00000134965]
Predicted Effect probably benign
Transcript: ENSMUST00000132121
SMART Domains Protein: ENSMUSP00000118779
Gene: ENSMUSG00000056899

DomainStartEndE-ValueType
Pfam:Peptidase_S24 38 115 7.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134965
SMART Domains Protein: ENSMUSP00000116441
Gene: ENSMUSG00000056899

DomainStartEndE-ValueType
Pfam:Peptidase_S24 38 114 6.4e-11 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in processing the signal peptide sequences used to direct mitochondrial proteins to the mitochondria. The encoded protein resides in the mitochondria and is one of the necessary proteins for the catalytic activity of the mitochondrial inner membrane peptidase (IMP) complex. Two variants that encode the same protein have been described for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced fertility, abnormal cellular respiration, and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,882,681 S691P probably benign Het
Adgrb3 T C 1: 25,226,831 probably null Het
Ankar A G 1: 72,679,555 probably benign Het
Aplf A T 6: 87,646,033 Y355N probably damaging Het
Bms1 A G 6: 118,389,389 probably benign Het
Catsperb T C 12: 101,463,114 I182T probably damaging Het
Cd300ld2 T C 11: 115,013,777 D88G probably benign Het
Cebpz T C 17: 78,934,752 N491S probably damaging Het
Crybg2 T C 4: 134,081,459 S1415P probably damaging Het
Ddc A G 11: 11,829,131 V331A probably benign Het
Decr2 T C 17: 26,083,024 E244G probably damaging Het
Dhrs11 A G 11: 84,823,117 M136T probably damaging Het
Eapp G A 12: 54,685,948 Q126* probably null Het
Fam111a T A 19: 12,587,778 V297D probably damaging Het
Fam84a G A 12: 14,150,408 A106V probably benign Het
Fbxo10 A C 4: 45,062,118 L136R probably damaging Het
Fbxo30 T A 10: 11,291,374 H613Q possibly damaging Het
Frk A T 10: 34,591,810 probably null Het
Gm10392 T A 11: 77,517,481 D104V probably benign Het
Gm960 T A 19: 4,652,171 K282N probably damaging Het
Gpn1 A G 5: 31,497,338 E78G possibly damaging Het
Hhip T C 8: 79,990,276 Y506C probably damaging Het
Hid1 G A 11: 115,356,750 S274L possibly damaging Het
Klhl21 T C 4: 152,009,624 F228L possibly damaging Het
Lamc1 T A 1: 153,243,478 probably null Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Magi2 T C 5: 19,227,332 V15A probably benign Het
Map2k7 T C 8: 4,243,621 probably null Het
Mga T A 2: 119,963,960 H2590Q possibly damaging Het
Mlxip T C 5: 123,450,223 I238T possibly damaging Het
Mylk T A 16: 34,875,586 D230E probably benign Het
Nacad T A 11: 6,601,185 T669S probably benign Het
Nin C T 12: 70,031,738 M1691I probably benign Het
Nlrp4d C T 7: 10,382,237 A203T probably damaging Het
Olfr1204 T G 2: 88,852,262 F104C probably damaging Het
Olfr1301 A T 2: 111,754,425 M59L probably damaging Het
Olfr1495 A T 19: 13,768,510 H56L probably benign Het
Olfr201 A G 16: 59,269,031 V212A probably benign Het
Olfr433 T C 1: 174,042,480 F177L probably benign Het
Olfr729 C A 14: 50,148,774 M33I probably benign Het
Osbp C A 19: 11,977,829 Q282K probably benign Het
Osbpl2 A G 2: 180,148,463 S177G probably damaging Het
Pax1 A G 2: 147,366,255 H261R possibly damaging Het
Pcif1 A T 2: 164,886,727 L274F probably damaging Het
Pkhd1 A G 1: 20,117,825 S3420P probably benign Het
Prss3 A C 6: 41,377,627 probably benign Het
Ptk2b T C 14: 66,163,114 T751A possibly damaging Het
Pus10 T C 11: 23,673,239 V126A probably damaging Het
Rai14 A C 15: 10,587,916 D258E probably damaging Het
Rbp3 T C 14: 33,954,524 V143A possibly damaging Het
Sarm1 G A 11: 78,483,327 Q625* probably null Het
Scgb1b21 T G 7: 33,527,667 noncoding transcript Het
Scrn1 A T 6: 54,520,769 V279E probably damaging Het
Sipa1l2 T C 8: 125,421,895 T1670A probably damaging Het
Slc9a4 A T 1: 40,600,962 I305F probably benign Het
Smarcc1 A G 9: 110,213,617 T918A probably damaging Het
Tas2r109 A T 6: 132,980,426 H180Q probably benign Het
Tas2r121 G A 6: 132,700,230 R260* probably null Het
Tenm3 T C 8: 48,279,074 D1249G probably benign Het
Tgtp1 C G 11: 48,987,530 G116A probably damaging Het
Tial1 A G 7: 128,443,910 Y317H probably damaging Het
Trim66 A T 7: 109,455,080 W1308R probably damaging Het
Ulk2 T G 11: 61,783,545 K878N possibly damaging Het
Zfp41 T A 15: 75,618,291 S31T possibly damaging Het
Other mutations in Immp2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01673:Immp2l APN 12 41068321 missense probably benign 0.26
IGL01696:Immp2l APN 12 41628807 missense probably damaging 1.00
IGL03082:Immp2l APN 12 41110901 missense possibly damaging 0.75
imp UTSW 12 41110847 nonsense probably null
R1636:Immp2l UTSW 12 41703687 missense probably damaging 1.00
R3404:Immp2l UTSW 12 41110847 nonsense probably null
R3405:Immp2l UTSW 12 41110847 nonsense probably null
R7238:Immp2l UTSW 12 41110916 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACAAATGTAGTGCTGGTTGGTTTCCA -3'
(R):5'- CACCCTTTGACCACCTAAAGGAATGT -3'

Sequencing Primer
(F):5'- gcataaacatattgggaagaaatcac -3'
(R):5'- TGTACCAACATAAAGTGTGTTCC -3'
Posted On2014-04-24