Incidental Mutation 'R1583:Olfr729'
ID177279
Institutional Source Beutler Lab
Gene Symbol Olfr729
Ensembl Gene ENSMUSG00000049011
Gene Nameolfactory receptor 729
SynonymsMOR246-6, GA_x6K02T2PMLR-5839874-5838903
MMRRC Submission 039620-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R1583 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50144731-50152910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 50148774 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 33 (M33I)
Ref Sequence ENSEMBL: ENSMUSP00000149189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061020] [ENSMUST00000213163] [ENSMUST00000215327] [ENSMUST00000215451]
Predicted Effect probably benign
Transcript: ENSMUST00000061020
AA Change: M33I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000051755
Gene: ENSMUSG00000049011
AA Change: M33I

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 8.3e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 286 1.4e-5 PFAM
Pfam:7tm_1 41 287 2.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213163
AA Change: M33I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000215327
AA Change: M33I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000215451
AA Change: M33I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,882,681 S691P probably benign Het
Adgrb3 T C 1: 25,226,831 probably null Het
Ankar A G 1: 72,679,555 probably benign Het
Aplf A T 6: 87,646,033 Y355N probably damaging Het
Bms1 A G 6: 118,389,389 probably benign Het
Catsperb T C 12: 101,463,114 I182T probably damaging Het
Cd300ld2 T C 11: 115,013,777 D88G probably benign Het
Cebpz T C 17: 78,934,752 N491S probably damaging Het
Crybg2 T C 4: 134,081,459 S1415P probably damaging Het
Ddc A G 11: 11,829,131 V331A probably benign Het
Decr2 T C 17: 26,083,024 E244G probably damaging Het
Dhrs11 A G 11: 84,823,117 M136T probably damaging Het
Eapp G A 12: 54,685,948 Q126* probably null Het
Fam111a T A 19: 12,587,778 V297D probably damaging Het
Fam84a G A 12: 14,150,408 A106V probably benign Het
Fbxo10 A C 4: 45,062,118 L136R probably damaging Het
Fbxo30 T A 10: 11,291,374 H613Q possibly damaging Het
Frk A T 10: 34,591,810 probably null Het
Gm10392 T A 11: 77,517,481 D104V probably benign Het
Gm960 T A 19: 4,652,171 K282N probably damaging Het
Gpn1 A G 5: 31,497,338 E78G possibly damaging Het
Hhip T C 8: 79,990,276 Y506C probably damaging Het
Hid1 G A 11: 115,356,750 S274L possibly damaging Het
Immp2l G T 12: 41,703,765 probably benign Het
Klhl21 T C 4: 152,009,624 F228L possibly damaging Het
Lamc1 T A 1: 153,243,478 probably null Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Magi2 T C 5: 19,227,332 V15A probably benign Het
Map2k7 T C 8: 4,243,621 probably null Het
Mga T A 2: 119,963,960 H2590Q possibly damaging Het
Mlxip T C 5: 123,450,223 I238T possibly damaging Het
Mylk T A 16: 34,875,586 D230E probably benign Het
Nacad T A 11: 6,601,185 T669S probably benign Het
Nin C T 12: 70,031,738 M1691I probably benign Het
Nlrp4d C T 7: 10,382,237 A203T probably damaging Het
Olfr1204 T G 2: 88,852,262 F104C probably damaging Het
Olfr1301 A T 2: 111,754,425 M59L probably damaging Het
Olfr1495 A T 19: 13,768,510 H56L probably benign Het
Olfr201 A G 16: 59,269,031 V212A probably benign Het
Olfr433 T C 1: 174,042,480 F177L probably benign Het
Osbp C A 19: 11,977,829 Q282K probably benign Het
Osbpl2 A G 2: 180,148,463 S177G probably damaging Het
Pax1 A G 2: 147,366,255 H261R possibly damaging Het
Pcif1 A T 2: 164,886,727 L274F probably damaging Het
Pkhd1 A G 1: 20,117,825 S3420P probably benign Het
Prss3 A C 6: 41,377,627 probably benign Het
Ptk2b T C 14: 66,163,114 T751A possibly damaging Het
Pus10 T C 11: 23,673,239 V126A probably damaging Het
Rai14 A C 15: 10,587,916 D258E probably damaging Het
Rbp3 T C 14: 33,954,524 V143A possibly damaging Het
Sarm1 G A 11: 78,483,327 Q625* probably null Het
Scgb1b21 T G 7: 33,527,667 noncoding transcript Het
Scrn1 A T 6: 54,520,769 V279E probably damaging Het
Sipa1l2 T C 8: 125,421,895 T1670A probably damaging Het
Slc9a4 A T 1: 40,600,962 I305F probably benign Het
Smarcc1 A G 9: 110,213,617 T918A probably damaging Het
Tas2r109 A T 6: 132,980,426 H180Q probably benign Het
Tas2r121 G A 6: 132,700,230 R260* probably null Het
Tenm3 T C 8: 48,279,074 D1249G probably benign Het
Tgtp1 C G 11: 48,987,530 G116A probably damaging Het
Tial1 A G 7: 128,443,910 Y317H probably damaging Het
Trim66 A T 7: 109,455,080 W1308R probably damaging Het
Ulk2 T G 11: 61,783,545 K878N possibly damaging Het
Zfp41 T A 15: 75,618,291 S31T possibly damaging Het
Other mutations in Olfr729
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01802:Olfr729 APN 14 50148716 missense probably benign 0.38
IGL02736:Olfr729 APN 14 50148424 missense probably benign 0.01
IGL02798:Olfr729 APN 14 50148378 missense probably benign
IGL03267:Olfr729 APN 14 50148847 missense probably damaging 1.00
R0082:Olfr729 UTSW 14 50148055 missense probably damaging 0.97
R0225:Olfr729 UTSW 14 50148635 missense probably damaging 1.00
R0503:Olfr729 UTSW 14 50148478 missense probably damaging 1.00
R1022:Olfr729 UTSW 14 50147927 missense probably benign
R1024:Olfr729 UTSW 14 50147927 missense probably benign
R1424:Olfr729 UTSW 14 50148465 missense possibly damaging 0.83
R1440:Olfr729 UTSW 14 50148358 missense probably damaging 1.00
R1479:Olfr729 UTSW 14 50148788 missense probably benign 0.00
R1817:Olfr729 UTSW 14 50148271 missense probably benign 0.00
R2155:Olfr729 UTSW 14 50148697 missense probably damaging 1.00
R2282:Olfr729 UTSW 14 50148319 missense probably benign
R2926:Olfr729 UTSW 14 50148436 missense probably benign 0.19
R3790:Olfr729 UTSW 14 50148569 missense possibly damaging 0.51
R4073:Olfr729 UTSW 14 50148043 missense possibly damaging 0.55
R5945:Olfr729 UTSW 14 50148763 missense probably benign
R6714:Olfr729 UTSW 14 50148214 missense possibly damaging 0.95
R7112:Olfr729 UTSW 14 50147935 missense probably benign 0.00
R7157:Olfr729 UTSW 14 50148232 missense probably damaging 1.00
R7511:Olfr729 UTSW 14 50148256 missense probably damaging 1.00
R7815:Olfr729 UTSW 14 50148796 missense probably benign 0.36
Z1177:Olfr729 UTSW 14 50148851 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCCAAGAGATTACTACCAAGGCA -3'
(R):5'- AGGCACTCTCATTAGCTCCTTCTGT -3'

Sequencing Primer
(F):5'- AATTTGGGCTATGCAGCCAC -3'
(R):5'- GTTGGCATGGTTGTTCAAATG -3'
Posted On2014-04-24