Incidental Mutation 'R1583:Ptk2b'
ID 177281
Institutional Source Beutler Lab
Gene Symbol Ptk2b
Ensembl Gene ENSMUSG00000059456
Gene Name PTK2 protein tyrosine kinase 2 beta
Synonyms proline-rich tyrosine kinase 2, related adhesion focal tyrosine kinase, cellular adhesion kinase beta, PYK2, CAKbeta, Raftk, calcium-dependent tyrosine kinase, E430023O05Rik
MMRRC Submission 039620-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.573) question?
Stock # R1583 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 66390706-66518501 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 66400563 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 751 (T751A)
Ref Sequence ENSEMBL: ENSMUSP00000106750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022622] [ENSMUST00000089250] [ENSMUST00000111121] [ENSMUST00000178730]
AlphaFold Q9QVP9
Predicted Effect probably benign
Transcript: ENSMUST00000022622
AA Change: T751A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000022622
Gene: ENSMUSG00000059456
AA Change: T751A

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 870 1008 1.7e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089250
SMART Domains Protein: ENSMUSP00000086661
Gene: ENSMUSG00000059456

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 828 966 2e-68 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111121
AA Change: T751A

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106750
Gene: ENSMUSG00000059456
AA Change: T751A

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 866 1004 1.1e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148104
Predicted Effect probably benign
Transcript: ENSMUST00000154865
SMART Domains Protein: ENSMUSP00000122683
Gene: ENSMUSG00000059456

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 83 8.5e-27 PFAM
low complexity region 117 130 N/A INTRINSIC
Pfam:Focal_AT 243 375 5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178730
AA Change: T751A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000137008
Gene: ENSMUSG00000059456
AA Change: T751A

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 870 1002 2.1e-55 PFAM
Meta Mutation Damage Score 0.0585 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is involved in calcium-induced regulation of ion channels and activation of the map kinase signaling pathway. The encoded protein may represent an important signaling intermediate between neuropeptide-activated receptors or neurotransmitters that increase calcium flux and the downstream signals that regulate neuronal activity. The encoded protein undergoes rapid tyrosine phosphorylation and activation in response to increases in the intracellular calcium concentration, nicotinic acetylcholine receptor activation, membrane depolarization, or protein kinase C activation. This protein has been shown to bind CRK-associated substrate, nephrocystin, GTPase regulator associated with FAK, and the SH2 domain of GRB2. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show alterations in endothelial nitric oxide synthase-mediated vascular function and angiogenic responses. Mice homozygous for a second knock-out allele exhibit multiple defects in macrophage migration and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 77,030,528 (GRCm39) S691P probably benign Het
Adgrb3 T C 1: 25,265,912 (GRCm39) probably null Het
Ankar A G 1: 72,718,714 (GRCm39) probably benign Het
Aplf A T 6: 87,623,015 (GRCm39) Y355N probably damaging Het
Bms1 A G 6: 118,366,350 (GRCm39) probably benign Het
Catsperb T C 12: 101,429,373 (GRCm39) I182T probably damaging Het
Cd300ld2 T C 11: 114,904,603 (GRCm39) D88G probably benign Het
Cebpz T C 17: 79,242,181 (GRCm39) N491S probably damaging Het
Crybg2 T C 4: 133,808,770 (GRCm39) S1415P probably damaging Het
Ddc A G 11: 11,779,131 (GRCm39) V331A probably benign Het
Decr2 T C 17: 26,301,998 (GRCm39) E244G probably damaging Het
Dhrs11 A G 11: 84,713,943 (GRCm39) M136T probably damaging Het
Eapp G A 12: 54,732,733 (GRCm39) Q126* probably null Het
Fam111a T A 19: 12,565,142 (GRCm39) V297D probably damaging Het
Fbxo10 A C 4: 45,062,118 (GRCm39) L136R probably damaging Het
Fbxo30 T A 10: 11,167,118 (GRCm39) H613Q possibly damaging Het
Frk A T 10: 34,467,806 (GRCm39) probably null Het
Gm10392 T A 11: 77,408,307 (GRCm39) D104V probably benign Het
Gpn1 A G 5: 31,654,682 (GRCm39) E78G possibly damaging Het
Hhip T C 8: 80,716,905 (GRCm39) Y506C probably damaging Het
Hid1 G A 11: 115,247,576 (GRCm39) S274L possibly damaging Het
Immp2l G T 12: 41,750,548 (GRCm39) probably benign Het
Klhl21 T C 4: 152,094,081 (GRCm39) F228L possibly damaging Het
Lamc1 T A 1: 153,119,224 (GRCm39) probably null Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lratd1 G A 12: 14,200,409 (GRCm39) A106V probably benign Het
Magi2 T C 5: 19,432,330 (GRCm39) V15A probably benign Het
Map2k7 T C 8: 4,293,621 (GRCm39) probably null Het
Mga T A 2: 119,794,441 (GRCm39) H2590Q possibly damaging Het
Mlxip T C 5: 123,588,286 (GRCm39) I238T possibly damaging Het
Mylk T A 16: 34,695,956 (GRCm39) D230E probably benign Het
Nacad T A 11: 6,551,185 (GRCm39) T669S probably benign Het
Nin C T 12: 70,078,512 (GRCm39) M1691I probably benign Het
Nlrp4d C T 7: 10,116,164 (GRCm39) A203T probably damaging Het
Or10aa1 T C 1: 173,870,046 (GRCm39) F177L probably benign Het
Or10q12 A T 19: 13,745,874 (GRCm39) H56L probably benign Het
Or4c106 T G 2: 88,682,606 (GRCm39) F104C probably damaging Het
Or4k5 C A 14: 50,386,231 (GRCm39) M33I probably benign Het
Or4k51 A T 2: 111,584,770 (GRCm39) M59L probably damaging Het
Or5ac19 A G 16: 59,089,394 (GRCm39) V212A probably benign Het
Osbp C A 19: 11,955,193 (GRCm39) Q282K probably benign Het
Osbpl2 A G 2: 179,790,256 (GRCm39) S177G probably damaging Het
Pax1 A G 2: 147,208,175 (GRCm39) H261R possibly damaging Het
Pcif1 A T 2: 164,728,647 (GRCm39) L274F probably damaging Het
Pkhd1 A G 1: 20,188,049 (GRCm39) S3420P probably benign Het
Prss3 A C 6: 41,354,561 (GRCm39) probably benign Het
Pus10 T C 11: 23,623,239 (GRCm39) V126A probably damaging Het
Rai14 A C 15: 10,588,002 (GRCm39) D258E probably damaging Het
Rbp3 T C 14: 33,676,481 (GRCm39) V143A possibly damaging Het
Sarm1 G A 11: 78,374,153 (GRCm39) Q625* probably null Het
Scgb1b21 T G 7: 33,227,092 (GRCm39) noncoding transcript Het
Scrn1 A T 6: 54,497,754 (GRCm39) V279E probably damaging Het
Sipa1l2 T C 8: 126,148,634 (GRCm39) T1670A probably damaging Het
Slc9a4 A T 1: 40,640,122 (GRCm39) I305F probably benign Het
Smarcc1 A G 9: 110,042,685 (GRCm39) T918A probably damaging Het
Tas2r109 A T 6: 132,957,389 (GRCm39) H180Q probably benign Het
Tas2r121 G A 6: 132,677,193 (GRCm39) R260* probably null Het
Tenm3 T C 8: 48,732,109 (GRCm39) D1249G probably benign Het
Tgtp1 C G 11: 48,878,357 (GRCm39) G116A probably damaging Het
Tial1 A G 7: 128,045,634 (GRCm39) Y317H probably damaging Het
Top6bl T A 19: 4,702,199 (GRCm39) K282N probably damaging Het
Trim66 A T 7: 109,054,287 (GRCm39) W1308R probably damaging Het
Ulk2 T G 11: 61,674,371 (GRCm39) K878N possibly damaging Het
Zfp41 T A 15: 75,490,140 (GRCm39) S31T possibly damaging Het
Other mutations in Ptk2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Ptk2b APN 14 66,414,567 (GRCm39) missense possibly damaging 0.54
IGL01940:Ptk2b APN 14 66,396,062 (GRCm39) missense probably benign 0.00
IGL02121:Ptk2b APN 14 66,450,931 (GRCm39) missense probably benign 0.12
IGL02505:Ptk2b APN 14 66,391,692 (GRCm39) missense probably damaging 1.00
IGL03036:Ptk2b APN 14 66,411,344 (GRCm39) splice site probably benign
IGL03343:Ptk2b APN 14 66,406,870 (GRCm39) missense probably benign 0.10
FR4548:Ptk2b UTSW 14 66,411,298 (GRCm39) missense possibly damaging 0.95
FR4737:Ptk2b UTSW 14 66,411,298 (GRCm39) missense possibly damaging 0.95
R0217:Ptk2b UTSW 14 66,393,830 (GRCm39) missense probably damaging 1.00
R0478:Ptk2b UTSW 14 66,450,821 (GRCm39) missense probably damaging 1.00
R0556:Ptk2b UTSW 14 66,409,593 (GRCm39) missense probably damaging 1.00
R0631:Ptk2b UTSW 14 66,415,200 (GRCm39) missense probably damaging 0.96
R0946:Ptk2b UTSW 14 66,396,047 (GRCm39) missense probably benign 0.02
R1502:Ptk2b UTSW 14 66,400,529 (GRCm39) missense possibly damaging 0.95
R1876:Ptk2b UTSW 14 66,395,841 (GRCm39) missense probably benign 0.01
R1905:Ptk2b UTSW 14 66,396,119 (GRCm39) missense probably damaging 1.00
R1942:Ptk2b UTSW 14 66,406,830 (GRCm39) missense probably damaging 1.00
R2048:Ptk2b UTSW 14 66,409,954 (GRCm39) missense probably benign 0.28
R2377:Ptk2b UTSW 14 66,409,997 (GRCm39) missense possibly damaging 0.56
R3021:Ptk2b UTSW 14 66,415,632 (GRCm39) splice site probably null
R3793:Ptk2b UTSW 14 66,407,700 (GRCm39) missense probably damaging 1.00
R3836:Ptk2b UTSW 14 66,393,791 (GRCm39) missense probably damaging 1.00
R3911:Ptk2b UTSW 14 66,394,517 (GRCm39) missense possibly damaging 0.83
R4654:Ptk2b UTSW 14 66,400,496 (GRCm39) missense possibly damaging 0.86
R4690:Ptk2b UTSW 14 66,410,749 (GRCm39) splice site probably null
R4691:Ptk2b UTSW 14 66,394,518 (GRCm39) missense probably benign 0.16
R4692:Ptk2b UTSW 14 66,394,518 (GRCm39) missense probably benign 0.16
R4693:Ptk2b UTSW 14 66,394,518 (GRCm39) missense probably benign 0.16
R4847:Ptk2b UTSW 14 66,411,331 (GRCm39) missense probably damaging 1.00
R5176:Ptk2b UTSW 14 66,393,864 (GRCm39) missense probably damaging 1.00
R5297:Ptk2b UTSW 14 66,409,966 (GRCm39) missense probably benign 0.04
R5603:Ptk2b UTSW 14 66,409,514 (GRCm39) nonsense probably null
R5935:Ptk2b UTSW 14 66,411,328 (GRCm39) missense probably damaging 1.00
R6245:Ptk2b UTSW 14 66,400,515 (GRCm39) missense probably damaging 1.00
R6313:Ptk2b UTSW 14 66,416,280 (GRCm39) missense probably damaging 1.00
R6476:Ptk2b UTSW 14 66,424,923 (GRCm39) missense possibly damaging 0.81
R6858:Ptk2b UTSW 14 66,450,847 (GRCm39) missense probably damaging 1.00
R7235:Ptk2b UTSW 14 66,394,536 (GRCm39) nonsense probably null
R7511:Ptk2b UTSW 14 66,391,693 (GRCm39) missense possibly damaging 0.81
R7558:Ptk2b UTSW 14 66,391,628 (GRCm39) missense possibly damaging 0.83
R7838:Ptk2b UTSW 14 66,395,850 (GRCm39) missense probably benign
R8520:Ptk2b UTSW 14 66,412,204 (GRCm39) missense probably damaging 1.00
R8672:Ptk2b UTSW 14 66,393,841 (GRCm39) missense probably benign 0.40
R8888:Ptk2b UTSW 14 66,412,242 (GRCm39) missense probably benign
R8895:Ptk2b UTSW 14 66,412,242 (GRCm39) missense probably benign
R8940:Ptk2b UTSW 14 66,407,685 (GRCm39) critical splice donor site probably null
R9164:Ptk2b UTSW 14 66,404,222 (GRCm39) missense possibly damaging 0.94
R9168:Ptk2b UTSW 14 66,424,899 (GRCm39) missense probably damaging 0.99
R9285:Ptk2b UTSW 14 66,410,844 (GRCm39) missense possibly damaging 0.67
R9346:Ptk2b UTSW 14 66,415,541 (GRCm39) missense possibly damaging 0.66
R9442:Ptk2b UTSW 14 66,409,189 (GRCm39) missense probably damaging 1.00
R9581:Ptk2b UTSW 14 66,450,789 (GRCm39) missense probably damaging 1.00
R9649:Ptk2b UTSW 14 66,413,154 (GRCm39) nonsense probably null
R9666:Ptk2b UTSW 14 66,409,546 (GRCm39) missense probably damaging 1.00
X0054:Ptk2b UTSW 14 66,450,777 (GRCm39) missense probably benign 0.15
Y5405:Ptk2b UTSW 14 66,391,543 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCAGGAGTCTGACTGGCACAC -3'
(R):5'- CACCTCTTCGGCAGGGAAATGATAC -3'

Sequencing Primer
(F):5'- TCTGACTGGCACACGGAAC -3'
(R):5'- AACCCATGTTTTATGTGCCACAG -3'
Posted On 2014-04-24