Incidental Mutation 'R1583:Rai14'
ID 177282
Institutional Source Beutler Lab
Gene Symbol Rai14
Ensembl Gene ENSMUSG00000022246
Gene Name retinoic acid induced 14
Synonyms 1700020L11Rik, Ankycorbin, 1700008J19Rik, Norpeg
MMRRC Submission 039620-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.654) question?
Stock # R1583 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 10569055-10714710 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 10588002 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 258 (D258E)
Ref Sequence ENSEMBL: ENSMUSP00000153969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090339] [ENSMUST00000169385] [ENSMUST00000227506]
AlphaFold Q9EP71
Predicted Effect probably damaging
Transcript: ENSMUST00000090339
AA Change: D287E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000087815
Gene: ENSMUSG00000022246
AA Change: D287E

DomainStartEndE-ValueType
Blast:ANK 18 48 4e-10 BLAST
ANK 52 81 1.66e-6 SMART
ANK 85 117 7.02e-5 SMART
ANK 118 147 2.1e-3 SMART
ANK 151 180 2.16e-5 SMART
ANK 184 213 2.85e-5 SMART
ANK 217 247 9.33e2 SMART
low complexity region 343 357 N/A INTRINSIC
Blast:HAMP 595 646 6e-19 BLAST
low complexity region 897 931 N/A INTRINSIC
Blast:ANK 944 977 6e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000169385
AA Change: D287E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126325
Gene: ENSMUSG00000022246
AA Change: D287E

DomainStartEndE-ValueType
Blast:ANK 18 48 4e-10 BLAST
ANK 52 81 1.66e-6 SMART
ANK 85 117 7.02e-5 SMART
ANK 118 147 2.1e-3 SMART
ANK 151 180 2.16e-5 SMART
ANK 184 213 2.85e-5 SMART
ANK 217 247 9.33e2 SMART
low complexity region 343 357 N/A INTRINSIC
Blast:HAMP 595 646 6e-19 BLAST
low complexity region 897 931 N/A INTRINSIC
Blast:ANK 944 977 6e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226737
Predicted Effect probably damaging
Transcript: ENSMUST00000227506
AA Change: D258E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0731 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 99% (79/80)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 77,030,528 (GRCm39) S691P probably benign Het
Adgrb3 T C 1: 25,265,912 (GRCm39) probably null Het
Ankar A G 1: 72,718,714 (GRCm39) probably benign Het
Aplf A T 6: 87,623,015 (GRCm39) Y355N probably damaging Het
Bms1 A G 6: 118,366,350 (GRCm39) probably benign Het
Catsperb T C 12: 101,429,373 (GRCm39) I182T probably damaging Het
Cd300ld2 T C 11: 114,904,603 (GRCm39) D88G probably benign Het
Cebpz T C 17: 79,242,181 (GRCm39) N491S probably damaging Het
Crybg2 T C 4: 133,808,770 (GRCm39) S1415P probably damaging Het
Ddc A G 11: 11,779,131 (GRCm39) V331A probably benign Het
Decr2 T C 17: 26,301,998 (GRCm39) E244G probably damaging Het
Dhrs11 A G 11: 84,713,943 (GRCm39) M136T probably damaging Het
Eapp G A 12: 54,732,733 (GRCm39) Q126* probably null Het
Fam111a T A 19: 12,565,142 (GRCm39) V297D probably damaging Het
Fbxo10 A C 4: 45,062,118 (GRCm39) L136R probably damaging Het
Fbxo30 T A 10: 11,167,118 (GRCm39) H613Q possibly damaging Het
Frk A T 10: 34,467,806 (GRCm39) probably null Het
Gm10392 T A 11: 77,408,307 (GRCm39) D104V probably benign Het
Gpn1 A G 5: 31,654,682 (GRCm39) E78G possibly damaging Het
Hhip T C 8: 80,716,905 (GRCm39) Y506C probably damaging Het
Hid1 G A 11: 115,247,576 (GRCm39) S274L possibly damaging Het
Immp2l G T 12: 41,750,548 (GRCm39) probably benign Het
Klhl21 T C 4: 152,094,081 (GRCm39) F228L possibly damaging Het
Lamc1 T A 1: 153,119,224 (GRCm39) probably null Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lratd1 G A 12: 14,200,409 (GRCm39) A106V probably benign Het
Magi2 T C 5: 19,432,330 (GRCm39) V15A probably benign Het
Map2k7 T C 8: 4,293,621 (GRCm39) probably null Het
Mga T A 2: 119,794,441 (GRCm39) H2590Q possibly damaging Het
Mlxip T C 5: 123,588,286 (GRCm39) I238T possibly damaging Het
Mylk T A 16: 34,695,956 (GRCm39) D230E probably benign Het
Nacad T A 11: 6,551,185 (GRCm39) T669S probably benign Het
Nin C T 12: 70,078,512 (GRCm39) M1691I probably benign Het
Nlrp4d C T 7: 10,116,164 (GRCm39) A203T probably damaging Het
Or10aa1 T C 1: 173,870,046 (GRCm39) F177L probably benign Het
Or10q12 A T 19: 13,745,874 (GRCm39) H56L probably benign Het
Or4c106 T G 2: 88,682,606 (GRCm39) F104C probably damaging Het
Or4k5 C A 14: 50,386,231 (GRCm39) M33I probably benign Het
Or4k51 A T 2: 111,584,770 (GRCm39) M59L probably damaging Het
Or5ac19 A G 16: 59,089,394 (GRCm39) V212A probably benign Het
Osbp C A 19: 11,955,193 (GRCm39) Q282K probably benign Het
Osbpl2 A G 2: 179,790,256 (GRCm39) S177G probably damaging Het
Pax1 A G 2: 147,208,175 (GRCm39) H261R possibly damaging Het
Pcif1 A T 2: 164,728,647 (GRCm39) L274F probably damaging Het
Pkhd1 A G 1: 20,188,049 (GRCm39) S3420P probably benign Het
Prss3 A C 6: 41,354,561 (GRCm39) probably benign Het
Ptk2b T C 14: 66,400,563 (GRCm39) T751A possibly damaging Het
Pus10 T C 11: 23,623,239 (GRCm39) V126A probably damaging Het
Rbp3 T C 14: 33,676,481 (GRCm39) V143A possibly damaging Het
Sarm1 G A 11: 78,374,153 (GRCm39) Q625* probably null Het
Scgb1b21 T G 7: 33,227,092 (GRCm39) noncoding transcript Het
Scrn1 A T 6: 54,497,754 (GRCm39) V279E probably damaging Het
Sipa1l2 T C 8: 126,148,634 (GRCm39) T1670A probably damaging Het
Slc9a4 A T 1: 40,640,122 (GRCm39) I305F probably benign Het
Smarcc1 A G 9: 110,042,685 (GRCm39) T918A probably damaging Het
Tas2r109 A T 6: 132,957,389 (GRCm39) H180Q probably benign Het
Tas2r121 G A 6: 132,677,193 (GRCm39) R260* probably null Het
Tenm3 T C 8: 48,732,109 (GRCm39) D1249G probably benign Het
Tgtp1 C G 11: 48,878,357 (GRCm39) G116A probably damaging Het
Tial1 A G 7: 128,045,634 (GRCm39) Y317H probably damaging Het
Top6bl T A 19: 4,702,199 (GRCm39) K282N probably damaging Het
Trim66 A T 7: 109,054,287 (GRCm39) W1308R probably damaging Het
Ulk2 T G 11: 61,674,371 (GRCm39) K878N possibly damaging Het
Zfp41 T A 15: 75,490,140 (GRCm39) S31T possibly damaging Het
Other mutations in Rai14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Rai14 APN 15 10,599,797 (GRCm39) splice site probably benign
IGL01625:Rai14 APN 15 10,572,460 (GRCm39) missense probably benign 0.30
IGL01925:Rai14 APN 15 10,595,948 (GRCm39) missense possibly damaging 0.88
IGL02053:Rai14 APN 15 10,633,242 (GRCm39) missense probably benign 0.00
IGL02531:Rai14 APN 15 10,574,868 (GRCm39) missense probably damaging 1.00
IGL02748:Rai14 APN 15 10,589,421 (GRCm39) missense probably benign 0.14
IGL02945:Rai14 APN 15 10,574,795 (GRCm39) missense probably benign 0.00
PIT4618001:Rai14 UTSW 15 10,575,242 (GRCm39) missense probably damaging 1.00
R1400:Rai14 UTSW 15 10,571,634 (GRCm39) missense probably damaging 0.98
R1686:Rai14 UTSW 15 10,592,282 (GRCm39) missense probably damaging 0.98
R1721:Rai14 UTSW 15 10,633,314 (GRCm39) missense probably damaging 1.00
R1867:Rai14 UTSW 15 10,633,314 (GRCm39) missense probably damaging 1.00
R1868:Rai14 UTSW 15 10,633,314 (GRCm39) missense probably damaging 1.00
R1998:Rai14 UTSW 15 10,595,067 (GRCm39) splice site probably null
R2118:Rai14 UTSW 15 10,575,252 (GRCm39) missense probably benign 0.00
R3161:Rai14 UTSW 15 10,633,250 (GRCm39) missense possibly damaging 0.74
R3162:Rai14 UTSW 15 10,633,250 (GRCm39) missense possibly damaging 0.74
R3162:Rai14 UTSW 15 10,633,250 (GRCm39) missense possibly damaging 0.74
R4049:Rai14 UTSW 15 10,592,298 (GRCm39) missense probably benign 0.30
R4611:Rai14 UTSW 15 10,592,224 (GRCm39) missense probably damaging 1.00
R4760:Rai14 UTSW 15 10,575,776 (GRCm39) missense possibly damaging 0.60
R4863:Rai14 UTSW 15 10,572,556 (GRCm39) missense probably damaging 0.99
R5022:Rai14 UTSW 15 10,574,592 (GRCm39) missense probably damaging 0.96
R5110:Rai14 UTSW 15 10,690,496 (GRCm39) start gained probably benign
R5410:Rai14 UTSW 15 10,575,024 (GRCm39) missense probably damaging 1.00
R5643:Rai14 UTSW 15 10,593,137 (GRCm39) missense probably benign 0.03
R5644:Rai14 UTSW 15 10,593,137 (GRCm39) missense probably benign 0.03
R5681:Rai14 UTSW 15 10,575,206 (GRCm39) missense probably damaging 1.00
R5934:Rai14 UTSW 15 10,575,245 (GRCm39) missense probably damaging 0.98
R6333:Rai14 UTSW 15 10,575,022 (GRCm39) nonsense probably null
R6338:Rai14 UTSW 15 10,575,062 (GRCm39) missense probably damaging 1.00
R6864:Rai14 UTSW 15 10,633,254 (GRCm39) missense possibly damaging 0.95
R7015:Rai14 UTSW 15 10,589,401 (GRCm39) nonsense probably null
R7155:Rai14 UTSW 15 10,595,089 (GRCm39) missense possibly damaging 0.53
R7480:Rai14 UTSW 15 10,571,622 (GRCm39) missense probably benign 0.02
R7574:Rai14 UTSW 15 10,593,189 (GRCm39) missense probably damaging 1.00
R7578:Rai14 UTSW 15 10,593,189 (GRCm39) missense probably damaging 1.00
R7578:Rai14 UTSW 15 10,574,914 (GRCm39) missense probably benign
R7597:Rai14 UTSW 15 10,574,937 (GRCm39) missense possibly damaging 0.94
R7658:Rai14 UTSW 15 10,593,189 (GRCm39) missense probably damaging 1.00
R7779:Rai14 UTSW 15 10,593,112 (GRCm39) missense probably damaging 1.00
R7946:Rai14 UTSW 15 10,574,287 (GRCm39) splice site probably null
R8171:Rai14 UTSW 15 10,633,249 (GRCm39) missense probably damaging 1.00
R8195:Rai14 UTSW 15 10,575,302 (GRCm39) missense probably benign
R8471:Rai14 UTSW 15 10,575,245 (GRCm39) missense probably benign 0.01
R8485:Rai14 UTSW 15 10,575,122 (GRCm39) missense probably damaging 1.00
R9075:Rai14 UTSW 15 10,589,403 (GRCm39) missense probably damaging 1.00
R9287:Rai14 UTSW 15 10,592,204 (GRCm39) missense probably benign 0.14
R9502:Rai14 UTSW 15 10,587,947 (GRCm39) missense possibly damaging 0.50
R9603:Rai14 UTSW 15 10,595,116 (GRCm39) nonsense probably null
R9665:Rai14 UTSW 15 10,574,803 (GRCm39) missense probably damaging 1.00
R9767:Rai14 UTSW 15 10,610,127 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGACAGGAGTGTCAACCCAGGAATA -3'
(R):5'- GAATGCCTTGAGAGTTTACCCCTGAAA -3'

Sequencing Primer
(F):5'- agtatatccactgagtcatcttcc -3'
(R):5'- TGAAACTCTACAAGCCTCCTGTTAG -3'
Posted On 2014-04-24