Incidental Mutation 'R1583:Lars'
ID177288
Institutional Source Beutler Lab
Gene Symbol Lars
Ensembl Gene ENSMUSG00000024493
Gene Nameleucyl-tRNA synthetase
Synonyms2310045K21Rik, 3110009L02Rik
MMRRC Submission 039620-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1583 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location42202350-42262122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 42210050 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 1101 (R1101C)
Ref Sequence ENSEMBL: ENSMUSP00000095197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097590]
Predicted Effect probably damaging
Transcript: ENSMUST00000097590
AA Change: R1101C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095197
Gene: ENSMUSG00000024493
AA Change: R1101C

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 19 112 5.8e-12 PFAM
Pfam:tRNA-synt_1g 48 114 3.5e-7 PFAM
low complexity region 141 157 N/A INTRINSIC
Pfam:tRNA-synt_1 173 758 3.6e-26 PFAM
Pfam:tRNA-synt_1g 632 764 1e-9 PFAM
Pfam:tRNA-synt_1e 660 761 2.8e-7 PFAM
Pfam:Anticodon_1 796 930 3e-18 PFAM
Blast:IL1 950 1086 4e-37 BLAST
Meta Mutation Damage Score 0.7391 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic leucine-tRNA synthetase, a member of the class I aminoacyl-tRNA synthetase family. The encoded enzyme catalyzes the ATP-dependent ligation of L-leucine to tRNA(Leu). It is found in the cytoplasm as part of a multisynthetase complex and interacts with the arginine tRNA synthetase through its C-terminal domain. A mutation in this gene was found in affected individuals with infantile liver failure syndrome 1. Alternatively spliced transcript variants of this gene have been observed. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,882,681 S691P probably benign Het
Adgrb3 T C 1: 25,226,831 probably null Het
Ankar A G 1: 72,679,555 probably benign Het
Aplf A T 6: 87,646,033 Y355N probably damaging Het
Bms1 A G 6: 118,389,389 probably benign Het
Catsperb T C 12: 101,463,114 I182T probably damaging Het
Cd300ld2 T C 11: 115,013,777 D88G probably benign Het
Cebpz T C 17: 78,934,752 N491S probably damaging Het
Crybg2 T C 4: 134,081,459 S1415P probably damaging Het
Ddc A G 11: 11,829,131 V331A probably benign Het
Decr2 T C 17: 26,083,024 E244G probably damaging Het
Dhrs11 A G 11: 84,823,117 M136T probably damaging Het
Eapp G A 12: 54,685,948 Q126* probably null Het
Fam111a T A 19: 12,587,778 V297D probably damaging Het
Fam84a G A 12: 14,150,408 A106V probably benign Het
Fbxo10 A C 4: 45,062,118 L136R probably damaging Het
Fbxo30 T A 10: 11,291,374 H613Q possibly damaging Het
Frk A T 10: 34,591,810 probably null Het
Gm10392 T A 11: 77,517,481 D104V probably benign Het
Gm960 T A 19: 4,652,171 K282N probably damaging Het
Gpn1 A G 5: 31,497,338 E78G possibly damaging Het
Hhip T C 8: 79,990,276 Y506C probably damaging Het
Hid1 G A 11: 115,356,750 S274L possibly damaging Het
Immp2l G T 12: 41,703,765 probably benign Het
Klhl21 T C 4: 152,009,624 F228L possibly damaging Het
Lamc1 T A 1: 153,243,478 probably null Het
Magi2 T C 5: 19,227,332 V15A probably benign Het
Map2k7 T C 8: 4,243,621 probably null Het
Mga T A 2: 119,963,960 H2590Q possibly damaging Het
Mlxip T C 5: 123,450,223 I238T possibly damaging Het
Mylk T A 16: 34,875,586 D230E probably benign Het
Nacad T A 11: 6,601,185 T669S probably benign Het
Nin C T 12: 70,031,738 M1691I probably benign Het
Nlrp4d C T 7: 10,382,237 A203T probably damaging Het
Olfr1204 T G 2: 88,852,262 F104C probably damaging Het
Olfr1301 A T 2: 111,754,425 M59L probably damaging Het
Olfr1495 A T 19: 13,768,510 H56L probably benign Het
Olfr201 A G 16: 59,269,031 V212A probably benign Het
Olfr433 T C 1: 174,042,480 F177L probably benign Het
Olfr729 C A 14: 50,148,774 M33I probably benign Het
Osbp C A 19: 11,977,829 Q282K probably benign Het
Osbpl2 A G 2: 180,148,463 S177G probably damaging Het
Pax1 A G 2: 147,366,255 H261R possibly damaging Het
Pcif1 A T 2: 164,886,727 L274F probably damaging Het
Pkhd1 A G 1: 20,117,825 S3420P probably benign Het
Prss3 A C 6: 41,377,627 probably benign Het
Ptk2b T C 14: 66,163,114 T751A possibly damaging Het
Pus10 T C 11: 23,673,239 V126A probably damaging Het
Rai14 A C 15: 10,587,916 D258E probably damaging Het
Rbp3 T C 14: 33,954,524 V143A possibly damaging Het
Sarm1 G A 11: 78,483,327 Q625* probably null Het
Scgb1b21 T G 7: 33,527,667 noncoding transcript Het
Scrn1 A T 6: 54,520,769 V279E probably damaging Het
Sipa1l2 T C 8: 125,421,895 T1670A probably damaging Het
Slc9a4 A T 1: 40,600,962 I305F probably benign Het
Smarcc1 A G 9: 110,213,617 T918A probably damaging Het
Tas2r109 A T 6: 132,980,426 H180Q probably benign Het
Tas2r121 G A 6: 132,700,230 R260* probably null Het
Tenm3 T C 8: 48,279,074 D1249G probably benign Het
Tgtp1 C G 11: 48,987,530 G116A probably damaging Het
Tial1 A G 7: 128,443,910 Y317H probably damaging Het
Trim66 A T 7: 109,455,080 W1308R probably damaging Het
Ulk2 T G 11: 61,783,545 K878N possibly damaging Het
Zfp41 T A 15: 75,618,291 S31T possibly damaging Het
Other mutations in Lars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Lars APN 18 42229654 missense probably damaging 0.99
IGL01340:Lars APN 18 42202577 missense probably benign 0.01
IGL01397:Lars APN 18 42228029 missense probably damaging 1.00
IGL01510:Lars APN 18 42242109 missense probably benign
IGL01542:Lars APN 18 42214827 missense probably benign 0.09
IGL01689:Lars APN 18 42216949 missense probably benign
IGL01819:Lars APN 18 42202550 missense probably benign 0.00
IGL02142:Lars APN 18 42227280 missense probably benign 0.01
IGL02598:Lars APN 18 42227277 missense possibly damaging 0.61
IGL02630:Lars APN 18 42257169 missense probably damaging 0.97
IGL02973:Lars APN 18 42214759 critical splice donor site probably null
IGL03064:Lars APN 18 42221571 nonsense probably null
IGL03081:Lars APN 18 42210091 missense probably benign 0.00
IGL03330:Lars APN 18 42219944 missense probably benign
IGL03334:Lars APN 18 42221506 missense probably benign
IGL03340:Lars APN 18 42228650 splice site probably benign
R0165:Lars UTSW 18 42202697 missense possibly damaging 0.91
R0321:Lars UTSW 18 42202632 missense probably damaging 0.96
R0325:Lars UTSW 18 42250902 missense possibly damaging 0.88
R0391:Lars UTSW 18 42251363 missense probably benign 0.00
R0558:Lars UTSW 18 42214837 missense probably benign
R0624:Lars UTSW 18 42242784 splice site probably benign
R0881:Lars UTSW 18 42214786 missense probably benign 0.22
R0968:Lars UTSW 18 42218583 missense probably benign 0.09
R1457:Lars UTSW 18 42210050 missense probably damaging 1.00
R1466:Lars UTSW 18 42210050 missense probably damaging 1.00
R1466:Lars UTSW 18 42210050 missense probably damaging 1.00
R1584:Lars UTSW 18 42210050 missense probably damaging 1.00
R1851:Lars UTSW 18 42212608 missense probably benign 0.09
R1852:Lars UTSW 18 42212608 missense probably benign 0.09
R1868:Lars UTSW 18 42214837 missense probably benign 0.04
R1954:Lars UTSW 18 42210050 missense probably damaging 1.00
R2277:Lars UTSW 18 42235502 missense probably benign 0.00
R3732:Lars UTSW 18 42212602 missense probably benign 0.00
R3732:Lars UTSW 18 42212602 missense probably benign 0.00
R3733:Lars UTSW 18 42212602 missense probably benign 0.00
R4208:Lars UTSW 18 42229703 missense probably benign 0.34
R4571:Lars UTSW 18 42228230 splice site probably null
R5009:Lars UTSW 18 42221547 missense probably benign 0.03
R5033:Lars UTSW 18 42214776 missense possibly damaging 0.92
R5152:Lars UTSW 18 42228777 missense possibly damaging 0.96
R5208:Lars UTSW 18 42217557 missense probably benign
R5219:Lars UTSW 18 42234720 missense probably benign 0.44
R5396:Lars UTSW 18 42216959 missense probably benign
R5433:Lars UTSW 18 42251298 missense possibly damaging 0.66
R5580:Lars UTSW 18 42214851 missense probably damaging 0.98
R5610:Lars UTSW 18 42257091 missense probably benign
R5784:Lars UTSW 18 42219899 missense probably benign 0.00
R6249:Lars UTSW 18 42257206 splice site probably null
R6334:Lars UTSW 18 42217486 missense probably benign
R6618:Lars UTSW 18 42244908 missense possibly damaging 0.86
R6900:Lars UTSW 18 42234610 missense probably benign
R6958:Lars UTSW 18 42236639 missense probably damaging 1.00
R7390:Lars UTSW 18 42210018 critical splice donor site probably null
R7451:Lars UTSW 18 42202550 missense probably benign 0.00
R7618:Lars UTSW 18 42244891 missense probably benign 0.10
R7831:Lars UTSW 18 42217562 missense probably benign 0.24
R7914:Lars UTSW 18 42217562 missense probably benign 0.24
R8003:Lars UTSW 18 42221619 missense probably damaging 1.00
X0064:Lars UTSW 18 42228060 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGGCGCTCAAGTGACACAGAAG -3'
(R):5'- AGTGTAGTCCATACACCAGGGCATC -3'

Sequencing Primer
(F):5'- CCCAAGGAAATCTATGTCTCCAGG -3'
(R):5'- AGGGCATCTTGGTGTAGACATAC -3'
Posted On2014-04-24