Mutagenetix > Incidental Mutations

Incidental Mutation 'R1583:Lars'

177288

Institutional Source

Beutler Lab

Gene Symbol

Lars

Ensembl Gene

ENSMUSG00000024493

Gene Name

leucyl-tRNA synthetase

Synonyms

2310045K21Rik, 3110009L02Rik

MMRRC Submission

039620-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1583 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

42202350-42262122 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 42210050 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 1101 (R1101C)

Ref Sequence

ENSEMBL: ENSMUSP00000095197 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097590]

AlphaFold

Q8BMJ2

Predicted Effect

probably damaging
Transcript: ENSMUST00000097590
AA Change: R1101C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000095197
Gene: ENSMUSG00000024493
AA Change: R1101C

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_1	19	112	5.8e-12	PFAM
Pfam:tRNA-synt_1g	48	114	3.5e-7	PFAM
low complexity region	141	157	N/A	INTRINSIC
Pfam:tRNA-synt_1	173	758	3.6e-26	PFAM
Pfam:tRNA-synt_1g	632	764	1e-9	PFAM
Pfam:tRNA-synt_1e	660	761	2.8e-7	PFAM
Pfam:Anticodon_1	796	930	3e-18	PFAM
Blast:IL1	950	1086	4e-37	BLAST

Meta Mutation Damage Score

0.7391

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.2%
20x: 88.8%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic leucine-tRNA synthetase, a member of the class I aminoacyl-tRNA synthetase family. The encoded enzyme catalyzes the ATP-dependent ligation of L-leucine to tRNA(Leu). It is found in the cytoplasm as part of a multisynthetase complex and interacts with the arginine tRNA synthetase through its C-terminal domain. A mutation in this gene was found in affected individuals with infantile liver failure syndrome 1. Alternatively spliced transcript variants of this gene have been observed. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	G	5: 76,882,681	S691P	probably benign	Het
Adgrb3	T	C	1: 25,226,831		probably null	Het
Ankar	A	G	1: 72,679,555		probably benign	Het
Aplf	A	T	6: 87,646,033	Y355N	probably damaging	Het
Bms1	A	G	6: 118,389,389		probably benign	Het
Catsperb	T	C	12: 101,463,114	I182T	probably damaging	Het
Cd300ld2	T	C	11: 115,013,777	D88G	probably benign	Het
Cebpz	T	C	17: 78,934,752	N491S	probably damaging	Het
Crybg2	T	C	4: 134,081,459	S1415P	probably damaging	Het
Ddc	A	G	11: 11,829,131	V331A	probably benign	Het
Decr2	T	C	17: 26,083,024	E244G	probably damaging	Het
Dhrs11	A	G	11: 84,823,117	M136T	probably damaging	Het
Eapp	G	A	12: 54,685,948	Q126*	probably null	Het
Fam111a	T	A	19: 12,587,778	V297D	probably damaging	Het
Fam84a	G	A	12: 14,150,408	A106V	probably benign	Het
Fbxo10	A	C	4: 45,062,118	L136R	probably damaging	Het
Fbxo30	T	A	10: 11,291,374	H613Q	possibly damaging	Het
Frk	A	T	10: 34,591,810		probably null	Het
Gm10392	T	A	11: 77,517,481	D104V	probably benign	Het
Gm960	T	A	19: 4,652,171	K282N	probably damaging	Het
Gpn1	A	G	5: 31,497,338	E78G	possibly damaging	Het
Hhip	T	C	8: 79,990,276	Y506C	probably damaging	Het
Hid1	G	A	11: 115,356,750	S274L	possibly damaging	Het
Immp2l	G	T	12: 41,703,765		probably benign	Het
Klhl21	T	C	4: 152,009,624	F228L	possibly damaging	Het
Lamc1	T	A	1: 153,243,478		probably null	Het
Magi2	T	C	5: 19,227,332	V15A	probably benign	Het
Map2k7	T	C	8: 4,243,621		probably null	Het
Mga	T	A	2: 119,963,960	H2590Q	possibly damaging	Het
Mlxip	T	C	5: 123,450,223	I238T	possibly damaging	Het
Mylk	T	A	16: 34,875,586	D230E	probably benign	Het
Nacad	T	A	11: 6,601,185	T669S	probably benign	Het
Nin	C	T	12: 70,031,738	M1691I	probably benign	Het
Nlrp4d	C	T	7: 10,382,237	A203T	probably damaging	Het
Olfr1204	T	G	2: 88,852,262	F104C	probably damaging	Het
Olfr1301	A	T	2: 111,754,425	M59L	probably damaging	Het
Olfr1495	A	T	19: 13,768,510	H56L	probably benign	Het
Olfr201	A	G	16: 59,269,031	V212A	probably benign	Het
Olfr433	T	C	1: 174,042,480	F177L	probably benign	Het
Olfr729	C	A	14: 50,148,774	M33I	probably benign	Het
Osbp	C	A	19: 11,977,829	Q282K	probably benign	Het
Osbpl2	A	G	2: 180,148,463	S177G	probably damaging	Het
Pax1	A	G	2: 147,366,255	H261R	possibly damaging	Het
Pcif1	A	T	2: 164,886,727	L274F	probably damaging	Het
Pkhd1	A	G	1: 20,117,825	S3420P	probably benign	Het
Prss3	A	C	6: 41,377,627		probably benign	Het
Ptk2b	T	C	14: 66,163,114	T751A	possibly damaging	Het
Pus10	T	C	11: 23,673,239	V126A	probably damaging	Het
Rai14	A	C	15: 10,587,916	D258E	probably damaging	Het
Rbp3	T	C	14: 33,954,524	V143A	possibly damaging	Het
Sarm1	G	A	11: 78,483,327	Q625*	probably null	Het
Scgb1b21	T	G	7: 33,527,667		noncoding transcript	Het
Scrn1	A	T	6: 54,520,769	V279E	probably damaging	Het
Sipa1l2	T	C	8: 125,421,895	T1670A	probably damaging	Het
Slc9a4	A	T	1: 40,600,962	I305F	probably benign	Het
Smarcc1	A	G	9: 110,213,617	T918A	probably damaging	Het
Tas2r109	A	T	6: 132,980,426	H180Q	probably benign	Het
Tas2r121	G	A	6: 132,700,230	R260*	probably null	Het
Tenm3	T	C	8: 48,279,074	D1249G	probably benign	Het
Tgtp1	C	G	11: 48,987,530	G116A	probably damaging	Het
Tial1	A	G	7: 128,443,910	Y317H	probably damaging	Het
Trim66	A	T	7: 109,455,080	W1308R	probably damaging	Het
Ulk2	T	G	11: 61,783,545	K878N	possibly damaging	Het
Zfp41	T	A	15: 75,618,291	S31T	possibly damaging	Het

Other mutations in Lars

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00534:Lars	APN	18	42229654	missense	probably damaging	0.99
IGL01340:Lars	APN	18	42202577	missense	probably benign	0.01
IGL01397:Lars	APN	18	42228029	missense	probably damaging	1.00
IGL01510:Lars	APN	18	42242109	missense	probably benign
IGL01542:Lars	APN	18	42214827	missense	probably benign	0.09
IGL01689:Lars	APN	18	42216949	missense	probably benign
IGL01819:Lars	APN	18	42202550	missense	probably benign	0.00
IGL02142:Lars	APN	18	42227280	missense	probably benign	0.01
IGL02598:Lars	APN	18	42227277	missense	possibly damaging	0.61
IGL02630:Lars	APN	18	42257169	missense	probably damaging	0.97
IGL02973:Lars	APN	18	42214759	critical splice donor site	probably null
IGL03064:Lars	APN	18	42221571	nonsense	probably null
IGL03081:Lars	APN	18	42210091	missense	probably benign	0.00
IGL03330:Lars	APN	18	42219944	missense	probably benign
IGL03334:Lars	APN	18	42221506	missense	probably benign
IGL03340:Lars	APN	18	42228650	splice site	probably benign
R0165:Lars	UTSW	18	42202697	missense	possibly damaging	0.91
R0321:Lars	UTSW	18	42202632	missense	probably damaging	0.96
R0325:Lars	UTSW	18	42250902	missense	possibly damaging	0.88
R0391:Lars	UTSW	18	42251363	missense	probably benign	0.00
R0558:Lars	UTSW	18	42214837	missense	probably benign
R0624:Lars	UTSW	18	42242784	splice site	probably benign
R0881:Lars	UTSW	18	42214786	missense	probably benign	0.22
R0968:Lars	UTSW	18	42218583	missense	probably benign	0.09
R1457:Lars	UTSW	18	42210050	missense	probably damaging	1.00
R1466:Lars	UTSW	18	42210050	missense	probably damaging	1.00
R1466:Lars	UTSW	18	42210050	missense	probably damaging	1.00
R1584:Lars	UTSW	18	42210050	missense	probably damaging	1.00
R1851:Lars	UTSW	18	42212608	missense	probably benign	0.09
R1852:Lars	UTSW	18	42212608	missense	probably benign	0.09
R1868:Lars	UTSW	18	42214837	missense	probably benign	0.04
R1954:Lars	UTSW	18	42210050	missense	probably damaging	1.00
R2277:Lars	UTSW	18	42235502	missense	probably benign	0.00
R3732:Lars	UTSW	18	42212602	missense	probably benign	0.00
R3732:Lars	UTSW	18	42212602	missense	probably benign	0.00
R3733:Lars	UTSW	18	42212602	missense	probably benign	0.00
R4208:Lars	UTSW	18	42229703	missense	probably benign	0.34
R4571:Lars	UTSW	18	42228230	splice site	probably null
R5009:Lars	UTSW	18	42221547	missense	probably benign	0.03
R5033:Lars	UTSW	18	42214776	missense	possibly damaging	0.92
R5152:Lars	UTSW	18	42228777	missense	possibly damaging	0.96
R5208:Lars	UTSW	18	42217557	missense	probably benign
R5219:Lars	UTSW	18	42234720	missense	probably benign	0.44
R5396:Lars	UTSW	18	42216959	missense	probably benign
R5433:Lars	UTSW	18	42251298	missense	possibly damaging	0.66
R5580:Lars	UTSW	18	42214851	missense	probably damaging	0.98
R5610:Lars	UTSW	18	42257091	missense	probably benign
R5784:Lars	UTSW	18	42219899	missense	probably benign	0.00
R6249:Lars	UTSW	18	42257206	splice site	probably null
R6334:Lars	UTSW	18	42217486	missense	probably benign
R6618:Lars	UTSW	18	42244908	missense	possibly damaging	0.86
R6900:Lars	UTSW	18	42234610	missense	probably benign
R6958:Lars	UTSW	18	42236639	missense	probably damaging	1.00
R7390:Lars	UTSW	18	42210018	critical splice donor site	probably null
R7451:Lars	UTSW	18	42202550	missense	probably benign	0.00
R7618:Lars	UTSW	18	42244891	missense	probably benign	0.10
R7831:Lars	UTSW	18	42217562	missense	probably benign	0.24
R7971:Lars	UTSW	18	42218566	missense	probably benign	0.06
R8003:Lars	UTSW	18	42221619	missense	probably damaging	1.00
R8082:Lars	UTSW	18	42244910	missense	probably damaging	0.98
R8144:Lars	UTSW	18	42218526	missense	probably damaging	0.98
R8181:Lars	UTSW	18	42228770	missense	probably damaging	0.98
R8196:Lars	UTSW	18	42210101	missense	possibly damaging	0.77
R8309:Lars	UTSW	18	42243028	missense	possibly damaging	0.54
R9039:Lars	UTSW	18	42257169	missense	probably damaging	0.97
R9306:Lars	UTSW	18	42225819	critical splice acceptor site	probably null
X0064:Lars	UTSW	18	42228060	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TGGCGCTCAAGTGACACAGAAG -3'
(R):5'- AGTGTAGTCCATACACCAGGGCATC -3'

Sequencing Primer
(F):5'- CCCAAGGAAATCTATGTCTCCAGG -3'
(R):5'- AGGGCATCTTGGTGTAGACATAC -3'

Posted On

2014-04-24