Mutagenetix > Incidental Mutation

Incidental Mutation 'R1584:Irs1'

177294

Institutional Source

Beutler Lab

Gene Symbol

Irs1

Ensembl Gene

ENSMUSG00000055980

Gene Name

insulin receptor substrate 1

Synonyms

G972R, IRS-1

MMRRC Submission

039621-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.622) question?

Stock #

R1584 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82233101-82291416 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 82289444 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 350 (H350Q)

Ref Sequence

ENSEMBL: ENSMUSP00000063795 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069799]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000069799
AA Change: H350Q

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000063795
Gene: ENSMUSG00000055980
AA Change: H350Q

Domain	Start	End	E-Value	Type
PH	13	117	8.13e-14	SMART
low complexity region	123	143	N/A	INTRINSIC
IRS	155	257	1.19e-35	SMART
PTBI	155	257	7.8e-60	SMART
low complexity region	263	276	N/A	INTRINSIC
low complexity region	378	399	N/A	INTRINSIC
low complexity region	407	419	N/A	INTRINSIC
low complexity region	551	568	N/A	INTRINSIC
low complexity region	662	689	N/A	INTRINSIC
low complexity region	784	794	N/A	INTRINSIC
low complexity region	801	810	N/A	INTRINSIC
low complexity region	824	837	N/A	INTRINSIC
low complexity region	1019	1040	N/A	INTRINSIC
low complexity region	1051	1062	N/A	INTRINSIC
low complexity region	1111	1127	N/A	INTRINSIC
low complexity region	1185	1200	N/A	INTRINSIC

Meta Mutation Damage Score

0.0707

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.2%

Validation Efficiency

99% (106/107)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit 50 percent reductions in body weights at birth and at 4 months of age, impaired glucose tolerance, and mild insulin and IGF-1 resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd15	C	T	11: 77,515,410	A71V	probably damaging	Het
Ager	A	G	17: 34,600,718	E357G	probably damaging	Het
Akap13	T	C	7: 75,729,049	S2095P	possibly damaging	Het
Ampd2	T	C	3: 108,080,337		probably null	Het
Arrdc1	T	C	2: 24,925,795	I398V	probably benign	Het
Ash1l	T	C	3: 89,052,065	Y2250H	probably damaging	Het
BC005561	T	A	5: 104,518,257	I215N	probably damaging	Het
Brca2	G	A	5: 150,552,258	A2478T	probably damaging	Het
Btrc	T	A	19: 45,513,382		probably benign	Het
C8g	C	T	2: 25,500,216	A6T	probably benign	Het
Cdc123	T	A	2: 5,803,977		probably null	Het
Cilp	G	A	9: 65,279,715	G1031S	probably damaging	Het
Cldn5	G	A	16: 18,777,477	G161D	probably damaging	Het
Cndp2	G	A	18: 84,677,315		probably benign	Het
Cntnap1	C	A	11: 101,180,360	F366L	probably damaging	Het
Corin	C	T	5: 72,302,790		probably null	Het
Ctdspl2	G	A	2: 122,003,929	R332K	probably benign	Het
Dido1	G	A	2: 180,662,328	P1261L	probably damaging	Het
Dopey1	A	T	9: 86,548,172	R2200*	probably null	Het
Dtx3l	G	A	16: 35,932,728	L503F	probably damaging	Het
Dysf	A	G	6: 84,067,047	K259R	probably benign	Het
Enpep	T	A	3: 129,319,448	T203S	probably damaging	Het
Epha2	T	A	4: 141,322,047		probably null	Het
Fam20b	T	C	1: 156,686,188		probably benign	Het
Fbln7	A	G	2: 128,877,429	T49A	probably benign	Het
Fgf14	T	A	14: 124,676,539	K60M	probably benign	Het
Fhad1	T	C	4: 141,985,511	I206V	probably benign	Het
Figla	A	G	6: 86,020,782	E164G	probably benign	Het
Gimap4	C	A	6: 48,691,282	Q196K	probably benign	Het
Glcci1	C	T	6: 8,537,964	T6I	probably damaging	Het
Gm6583	C	T	5: 112,354,764	G358D	probably benign	Het
Grk4	T	C	5: 34,694,750	S113P	probably benign	Het
Hectd3	G	A	4: 116,996,566	E220K	probably damaging	Het
Hecw1	A	G	13: 14,340,743		probably null	Het
Helz2	G	A	2: 181,236,297	P903S	probably damaging	Het
Hydin	T	C	8: 110,580,815	V3942A	probably benign	Het
Kdm1b	G	A	13: 47,064,054	E46K	probably damaging	Het
Klf11	A	G	12: 24,655,305	N253D	probably damaging	Het
Klhl23	T	C	2: 69,833,888	I527T	probably damaging	Het
Lars	G	A	18: 42,210,050	R1101C	probably damaging	Het
Lcn4	G	A	2: 26,668,576	P166L	probably damaging	Het
Letmd1	T	A	15: 100,472,542		probably null	Het
Lilra6	T	A	7: 3,912,662	D358V	probably damaging	Het
Mmrn2	A	G	14: 34,375,685	D24G	probably benign	Het
Mpp5	A	G	12: 78,829,727	I482V	probably benign	Het
Mroh2b	G	T	15: 4,925,684	D720Y	probably damaging	Het
Mrps35	C	T	6: 147,055,984	T169M	probably damaging	Het
Muc4	G	A	16: 32,753,595	G1157D	probably benign	Het
Naga	T	A	15: 82,334,788	M237L	probably null	Het
Nfu1	G	A	6: 87,020,809	E225K	probably damaging	Het
Nin	A	T	12: 70,042,669	L1324Q	probably benign	Het
Oc90	T	A	15: 65,897,720	Y96F	probably damaging	Het
Olfr1029	T	A	2: 85,975,995	F251I	probably damaging	Het
Olfr1253	C	T	2: 89,752,267	C187Y	probably damaging	Het
Olfr1471	T	C	19: 13,445,659	Y216H	probably damaging	Het
Olfr25	G	A	9: 38,330,131	M181I	possibly damaging	Het
Olfr522	A	G	7: 140,162,203	V249A	probably damaging	Het
Orc4	A	T	2: 48,909,494	C324S	possibly damaging	Het
Pdzrn4	T	C	15: 92,770,537	S857P	probably benign	Het
Plec	C	T	15: 76,185,908	E1000K	possibly damaging	Het
Plvap	A	T	8: 71,508,481	V149D	probably benign	Het
Pm20d2	A	T	4: 33,174,772	N371K	probably damaging	Het
Ppp2r5d	A	G	17: 46,684,684	Y480H	probably benign	Het
Prkd1	A	T	12: 50,425,515	V205E	probably damaging	Het
R3hdm2	A	G	10: 127,476,690	I434V	probably benign	Het
Rel	T	A	11: 23,745,546	T246S	probably damaging	Het
Rnf215	T	A	11: 4,136,719	V172E	probably damaging	Het
Scara3	T	C	14: 65,921,104	D485G	probably damaging	Het
Sec16a	A	T	2: 26,431,157	Y1308N	probably damaging	Het
Sis	A	T	3: 72,932,060	D824E	possibly damaging	Het
Slc27a4	T	A	2: 29,811,190	V331E	probably damaging	Het
Srebf1	C	T	11: 60,200,702	R999H	probably benign	Het
St3gal3	A	C	4: 118,107,662	M1R	probably null	Het
Tapbp	C	T	17: 33,919,940		probably null	Het
Tep1	A	T	14: 50,866,037	N265K	probably damaging	Het
Tln2	T	A	9: 67,296,414	N470I	probably damaging	Het
Trim43a	G	T	9: 88,588,158	W339L	probably damaging	Het
Ttc22	T	C	4: 106,622,780	F77S	probably damaging	Het
Ttc8	A	G	12: 98,920,764	E32G	probably benign	Het
Uhmk1	A	T	1: 170,208,653		probably null	Het
Usp17lc	A	G	7: 103,418,941	H481R	possibly damaging	Het
Vamp8	G	A	6: 72,385,634	T35M	probably damaging	Het
Vill	A	G	9: 119,065,586	Y53C	probably damaging	Het
Vmn1r222	A	T	13: 23,232,762	S94T	probably damaging	Het
Vmn2r93	A	G	17: 18,305,151	Y357C	possibly damaging	Het
Vps13c	T	A	9: 67,893,112	V536D	possibly damaging	Het
Vrtn	G	A	12: 84,650,081	C535Y	probably damaging	Het
Vwa3a	A	G	7: 120,768,165	Y181C	probably damaging	Het
Wfikkn2	G	A	11: 94,238,895	T140I	probably damaging	Het
Ykt6	T	A	11: 5,962,349	F101I	probably damaging	Het
Zfp277	C	T	12: 40,378,826	G174D	probably benign	Het
Zfp638	A	G	6: 83,978,065		probably null	Het
Zzef1	C	T	11: 72,924,679	P2942S	probably damaging	Het

Other mutations in Irs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Irs1	APN	1	82288483	missense	probably benign	0.01
IGL00534:Irs1	APN	1	82288471	missense	probably benign
IGL01926:Irs1	APN	1	82289959	missense	probably damaging	0.98
IGL02130:Irs1	APN	1	82289467	missense	probably damaging	1.00
IGL03338:Irs1	APN	1	82288401	missense	probably benign	0.05
Hoverboard	UTSW	1	82290098	nonsense	probably null
runt	UTSW	1	82287732	frame shift	probably null
runt2	UTSW	1	82286967	nonsense	probably null
Sprite	UTSW	1	82288109	nonsense	probably null
R0019:Irs1	UTSW	1	82287256	nonsense	probably null
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0318:Irs1	UTSW	1	82288660	missense	probably benign	0.01
R1199:Irs1	UTSW	1	82289626	missense	probably damaging	1.00
R1363:Irs1	UTSW	1	82287288	missense	probably benign	0.02
R1874:Irs1	UTSW	1	82289853	frame shift	probably null
R1903:Irs1	UTSW	1	82289461	missense	probably damaging	1.00
R1929:Irs1	UTSW	1	82288459	missense	probably benign
R1986:Irs1	UTSW	1	82288765	missense	probably damaging	1.00
R2136:Irs1	UTSW	1	82290042	missense	probably damaging	1.00
R2179:Irs1	UTSW	1	82290219	missense	possibly damaging	0.81
R2271:Irs1	UTSW	1	82288459	missense	probably benign
R2760:Irs1	UTSW	1	82288570	missense	probably damaging	1.00
R3721:Irs1	UTSW	1	82290085	missense	probably benign	0.11
R3821:Irs1	UTSW	1	82290049	missense	probably benign
R4306:Irs1	UTSW	1	82287964	missense	probably benign	0.11
R4420:Irs1	UTSW	1	82288450	missense	possibly damaging	0.94
R4451:Irs1	UTSW	1	82289028	missense	probably benign	0.00
R4479:Irs1	UTSW	1	82287294	missense	probably damaging	1.00
R4771:Irs1	UTSW	1	82287975	missense	probably benign	0.00
R4782:Irs1	UTSW	1	82287463	missense	probably benign	0.00
R4836:Irs1	UTSW	1	82287732	frame shift	probably null
R4880:Irs1	UTSW	1	82287732	frame shift	probably null
R4881:Irs1	UTSW	1	82287732	frame shift	probably null
R5031:Irs1	UTSW	1	82286967	nonsense	probably null
R5053:Irs1	UTSW	1	82286922	missense	probably benign
R5418:Irs1	UTSW	1	82288770	missense	probably damaging	1.00
R5595:Irs1	UTSW	1	82289925	missense	probably damaging	1.00
R5698:Irs1	UTSW	1	82288734	missense	probably benign	0.01
R6381:Irs1	UTSW	1	82287684	missense	possibly damaging	0.66
R6563:Irs1	UTSW	1	82288407	missense	probably damaging	0.98
R7002:Irs1	UTSW	1	82288260	missense	probably benign	0.13
R7095:Irs1	UTSW	1	82290098	nonsense	probably null
R7195:Irs1	UTSW	1	82287456	missense	probably benign	0.13
R7216:Irs1	UTSW	1	82289755	missense	probably damaging	0.98
R7361:Irs1	UTSW	1	82289114	nonsense	probably null
R7490:Irs1	UTSW	1	82287264	missense	probably damaging	0.99
R7540:Irs1	UTSW	1	82288002	missense	not run
R7706:Irs1	UTSW	1	82287691	missense	probably damaging	1.00
R7910:Irs1	UTSW	1	82290081	missense	probably benign	0.06
R7912:Irs1	UTSW	1	82289884	missense	probably benign
R7962:Irs1	UTSW	1	82288722	missense	possibly damaging	0.57
R8139:Irs1	UTSW	1	82289739	missense	probably damaging	1.00
R8158:Irs1	UTSW	1	82289533	missense	probably damaging	1.00
R8159:Irs1	UTSW	1	82288569	missense	probably damaging	1.00
R8187:Irs1	UTSW	1	82288300	missense	probably damaging	1.00
R8288:Irs1	UTSW	1	82287961	nonsense	probably null
R8436:Irs1	UTSW	1	82290249	missense	possibly damaging	0.96
R8865:Irs1	UTSW	1	82288109	nonsense	probably null
R8950:Irs1	UTSW	1	82286931	missense	probably benign
R9591:Irs1	UTSW	1	82288248	missense	probably benign	0.00
X0063:Irs1	UTSW	1	82288908	missense	probably damaging	1.00
X0065:Irs1	UTSW	1	82289365	missense	probably damaging	1.00
Z1177:Irs1	UTSW	1	82288996	missense	possibly damaging	0.87
Z1177:Irs1	UTSW	1	82290394	missense	probably benign	0.29

Predicted Primers

PCR Primer
(F):5'- CTTCGGAAATCGCAGGGACTAGAAC -3'
(R):5'- TCGAACTGAGAGCATCACTGCCAC -3'

Sequencing Primer
(F):5'- TGAAACCGCCATCGCTAGG -3'
(R):5'- ACCTCCCCTGCCAGTATGG -3'

Posted On

2014-04-24