Incidental Mutation 'R1584:Arrdc1'
ID 177299
Institutional Source Beutler Lab
Gene Symbol Arrdc1
Ensembl Gene ENSMUSG00000026972
Gene Name arrestin domain containing 1
Synonyms
MMRRC Submission 039621-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1584 (G1)
Quality Score 223
Status Validated
Chromosome 2
Chromosomal Location 24815364-24825264 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 24815807 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 398 (I398V)
Ref Sequence ENSEMBL: ENSMUSP00000099999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028349] [ENSMUST00000102935] [ENSMUST00000133934] [ENSMUST00000142887] [ENSMUST00000144963]
AlphaFold Q99KN1
Predicted Effect probably benign
Transcript: ENSMUST00000028349
AA Change: I399V

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000028349
Gene: ENSMUSG00000026972
AA Change: I399V

DomainStartEndE-ValueType
Pfam:Arrestin_N 7 139 8.5e-19 PFAM
Arrestin_C 162 286 1.19e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102935
AA Change: I398V

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099999
Gene: ENSMUSG00000026972
AA Change: I398V

DomainStartEndE-ValueType
Pfam:Arrestin_N 7 139 4.1e-31 PFAM
Arrestin_C 162 285 2.7e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129784
Predicted Effect probably benign
Transcript: ENSMUST00000132074
SMART Domains Protein: ENSMUSP00000116352
Gene: ENSMUSG00000026972

DomainStartEndE-ValueType
Blast:Arrestin_C 2 84 4e-48 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133396
Predicted Effect probably benign
Transcript: ENSMUST00000133934
SMART Domains Protein: ENSMUSP00000117695
Gene: ENSMUSG00000026972

DomainStartEndE-ValueType
Pfam:Arrestin_N 38 102 1.4e-16 PFAM
Pfam:Arrestin_C 125 210 1.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142887
SMART Domains Protein: ENSMUSP00000117372
Gene: ENSMUSG00000026972

DomainStartEndE-ValueType
Pfam:Arrestin_N 6 95 2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155525
Predicted Effect probably benign
Transcript: ENSMUST00000144963
SMART Domains Protein: ENSMUSP00000114684
Gene: ENSMUSG00000026972

DomainStartEndE-ValueType
Blast:Arrestin_C 3 58 5e-21 BLAST
Meta Mutation Damage Score 0.1197 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.2%
Validation Efficiency 99% (106/107)
MGI Phenotype PHENOTYPE: Homozygous null mouse embryonic fibroblasts exhibit reduced extracellular vesicle release. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C T 11: 77,406,236 (GRCm39) A71V probably damaging Het
Ager A G 17: 34,819,692 (GRCm39) E357G probably damaging Het
Akap13 T C 7: 75,378,797 (GRCm39) S2095P possibly damaging Het
Ampd2 T C 3: 107,987,653 (GRCm39) probably null Het
Ash1l T C 3: 88,959,372 (GRCm39) Y2250H probably damaging Het
Brca2 G A 5: 150,475,723 (GRCm39) A2478T probably damaging Het
Btrc T A 19: 45,501,821 (GRCm39) probably benign Het
C8g C T 2: 25,390,228 (GRCm39) A6T probably benign Het
Ccdc121rt3 C T 5: 112,502,630 (GRCm39) G358D probably benign Het
Cdc123 T A 2: 5,808,788 (GRCm39) probably null Het
Cilp G A 9: 65,186,997 (GRCm39) G1031S probably damaging Het
Cldn5 G A 16: 18,596,227 (GRCm39) G161D probably damaging Het
Cndp2 G A 18: 84,695,440 (GRCm39) probably benign Het
Cntnap1 C A 11: 101,071,186 (GRCm39) F366L probably damaging Het
Corin C T 5: 72,460,133 (GRCm39) probably null Het
Ctdspl2 G A 2: 121,834,410 (GRCm39) R332K probably benign Het
Dido1 G A 2: 180,304,121 (GRCm39) P1261L probably damaging Het
Dop1a A T 9: 86,430,225 (GRCm39) R2200* probably null Het
Dtx3l G A 16: 35,753,098 (GRCm39) L503F probably damaging Het
Dysf A G 6: 84,044,029 (GRCm39) K259R probably benign Het
Enpep T A 3: 129,113,097 (GRCm39) T203S probably damaging Het
Epha2 T A 4: 141,049,358 (GRCm39) probably null Het
Fam20b T C 1: 156,513,758 (GRCm39) probably benign Het
Fbln7 A G 2: 128,719,349 (GRCm39) T49A probably benign Het
Fgf14 T A 14: 124,913,951 (GRCm39) K60M probably benign Het
Fhad1 T C 4: 141,712,822 (GRCm39) I206V probably benign Het
Figla A G 6: 85,997,764 (GRCm39) E164G probably benign Het
Gimap4 C A 6: 48,668,216 (GRCm39) Q196K probably benign Het
Glcci1 C T 6: 8,537,964 (GRCm39) T6I probably damaging Het
Grk4 T C 5: 34,852,094 (GRCm39) S113P probably benign Het
Hectd3 G A 4: 116,853,763 (GRCm39) E220K probably damaging Het
Hecw1 A G 13: 14,515,328 (GRCm39) probably null Het
Helz2 G A 2: 180,878,090 (GRCm39) P903S probably damaging Het
Hydin T C 8: 111,307,447 (GRCm39) V3942A probably benign Het
Irs1 G T 1: 82,267,165 (GRCm39) H350Q probably benign Het
Kdm1b G A 13: 47,217,530 (GRCm39) E46K probably damaging Het
Klf11 A G 12: 24,705,304 (GRCm39) N253D probably damaging Het
Klhl23 T C 2: 69,664,232 (GRCm39) I527T probably damaging Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lcn4 G A 2: 26,558,588 (GRCm39) P166L probably damaging Het
Letmd1 T A 15: 100,370,423 (GRCm39) probably null Het
Lilra6 T A 7: 3,915,661 (GRCm39) D358V probably damaging Het
Mmrn2 A G 14: 34,097,642 (GRCm39) D24G probably benign Het
Mroh2b G T 15: 4,955,166 (GRCm39) D720Y probably damaging Het
Mrps35 C T 6: 146,957,482 (GRCm39) T169M probably damaging Het
Muc4 G A 16: 32,574,886 (GRCm39) G1157D probably benign Het
Naga T A 15: 82,218,989 (GRCm39) M237L probably null Het
Nfu1 G A 6: 86,997,791 (GRCm39) E225K probably damaging Het
Nin A T 12: 70,089,443 (GRCm39) L1324Q probably benign Het
Oc90 T A 15: 65,769,569 (GRCm39) Y96F probably damaging Het
Or4a80 C T 2: 89,582,611 (GRCm39) C187Y probably damaging Het
Or5b116 T C 19: 13,423,023 (GRCm39) Y216H probably damaging Het
Or5m11b T A 2: 85,806,339 (GRCm39) F251I probably damaging Het
Or6ae1 A G 7: 139,742,116 (GRCm39) V249A probably damaging Het
Or8c9 G A 9: 38,241,427 (GRCm39) M181I possibly damaging Het
Orc4 A T 2: 48,799,506 (GRCm39) C324S possibly damaging Het
Pals1 A G 12: 78,876,501 (GRCm39) I482V probably benign Het
Pdzrn4 T C 15: 92,668,418 (GRCm39) S857P probably benign Het
Plec C T 15: 76,070,108 (GRCm39) E1000K possibly damaging Het
Plvap A T 8: 71,961,125 (GRCm39) V149D probably benign Het
Pm20d2 A T 4: 33,174,772 (GRCm39) N371K probably damaging Het
Ppp2r5d A G 17: 46,995,610 (GRCm39) Y480H probably benign Het
Prkd1 A T 12: 50,472,298 (GRCm39) V205E probably damaging Het
R3hdm2 A G 10: 127,312,559 (GRCm39) I434V probably benign Het
Rel T A 11: 23,695,546 (GRCm39) T246S probably damaging Het
Rnf215 T A 11: 4,086,719 (GRCm39) V172E probably damaging Het
Scara3 T C 14: 66,158,553 (GRCm39) D485G probably damaging Het
Sec16a A T 2: 26,321,169 (GRCm39) Y1308N probably damaging Het
Sis A T 3: 72,839,393 (GRCm39) D824E possibly damaging Het
Slc27a4 T A 2: 29,701,202 (GRCm39) V331E probably damaging Het
Srebf1 C T 11: 60,091,528 (GRCm39) R999H probably benign Het
St3gal3 A C 4: 117,964,859 (GRCm39) M1R probably null Het
Tapbp C T 17: 34,138,914 (GRCm39) probably null Het
Tep1 A T 14: 51,103,494 (GRCm39) N265K probably damaging Het
Thoc2l T A 5: 104,666,123 (GRCm39) I215N probably damaging Het
Tln2 T A 9: 67,203,696 (GRCm39) N470I probably damaging Het
Trim43a G T 9: 88,470,211 (GRCm39) W339L probably damaging Het
Ttc22 T C 4: 106,479,977 (GRCm39) F77S probably damaging Het
Ttc8 A G 12: 98,887,023 (GRCm39) E32G probably benign Het
Uhmk1 A T 1: 170,036,222 (GRCm39) probably null Het
Usp17lc A G 7: 103,068,148 (GRCm39) H481R possibly damaging Het
Vamp8 G A 6: 72,362,617 (GRCm39) T35M probably damaging Het
Vill A G 9: 118,894,654 (GRCm39) Y53C probably damaging Het
Vmn1r222 A T 13: 23,416,932 (GRCm39) S94T probably damaging Het
Vmn2r93 A G 17: 18,525,413 (GRCm39) Y357C possibly damaging Het
Vps13c T A 9: 67,800,394 (GRCm39) V536D possibly damaging Het
Vrtn G A 12: 84,696,855 (GRCm39) C535Y probably damaging Het
Vwa3a A G 7: 120,367,388 (GRCm39) Y181C probably damaging Het
Wfikkn2 G A 11: 94,129,721 (GRCm39) T140I probably damaging Het
Ykt6 T A 11: 5,912,349 (GRCm39) F101I probably damaging Het
Zfp277 C T 12: 40,428,825 (GRCm39) G174D probably benign Het
Zfp638 A G 6: 83,955,047 (GRCm39) probably null Het
Zzef1 C T 11: 72,815,505 (GRCm39) P2942S probably damaging Het
Other mutations in Arrdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Arrdc1 APN 2 24,816,164 (GRCm39) missense possibly damaging 0.93
IGL02510:Arrdc1 APN 2 24,825,112 (GRCm39) missense probably damaging 1.00
IGL03307:Arrdc1 APN 2 24,816,354 (GRCm39) missense probably damaging 0.99
PIT4378001:Arrdc1 UTSW 2 24,816,645 (GRCm39) missense probably damaging 1.00
R1192:Arrdc1 UTSW 2 24,816,152 (GRCm39) missense probably benign 0.22
R1466:Arrdc1 UTSW 2 24,815,807 (GRCm39) missense probably benign 0.04
R1466:Arrdc1 UTSW 2 24,815,807 (GRCm39) missense probably benign 0.04
R1550:Arrdc1 UTSW 2 24,816,351 (GRCm39) missense probably damaging 1.00
R2061:Arrdc1 UTSW 2 24,816,364 (GRCm39) nonsense probably null
R2157:Arrdc1 UTSW 2 24,816,987 (GRCm39) missense probably damaging 1.00
R4904:Arrdc1 UTSW 2 24,816,676 (GRCm39) missense possibly damaging 0.93
R4946:Arrdc1 UTSW 2 24,815,860 (GRCm39) missense probably benign 0.36
R5632:Arrdc1 UTSW 2 24,817,840 (GRCm39) missense probably benign 0.01
R5766:Arrdc1 UTSW 2 24,816,417 (GRCm39) missense probably damaging 0.99
R6875:Arrdc1 UTSW 2 24,815,677 (GRCm39) missense probably benign 0.19
R7860:Arrdc1 UTSW 2 24,816,158 (GRCm39) missense probably damaging 1.00
R9136:Arrdc1 UTSW 2 24,817,193 (GRCm39) splice site probably benign
Predicted Primers PCR Primer
(F):5'- TGGACATTCCATGCCAAGGCAAAG -3'
(R):5'- TCTGTGTCTGTCACCACCACTGAG -3'

Sequencing Primer
(F):5'- TGGTATGGGTTAGCACACCAG -3'
(R):5'- ACCACCACTGAGCCCTG -3'
Posted On 2014-04-24